PEX13 cDNA ORF Clone, Human, untagged

Cat: HG15376-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PEX13 Reagents
CRO Services
Product recommended

All PEX13 Reagents
PEX13 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1212 bp
Description
Full length Clone DNA of Human peroxisomal biogenesis factor 13.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PEX13 cDNA ORF Clone, Human, untagged Alternative Names
NALD cDNA ORF Clone, Human;PBD11A cDNA ORF Clone, Human;PBD11B cDNA ORF Clone, Human;ZWS cDNA ORF Clone, Human
PEX13 Background Information
Full Name
peroxisomal biogenesis factor 13

PEX13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PEX13 cDNA ORF Clone in Cloning Vector, Mouse MG5A0929-U
PEX13 cDNA ORF Clone, Mouse, untagged MG5A0929-UT
PEX13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0929-ACGLN
PEX13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0929-ACG
PEX13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0929-ANG
PEX13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0929-ACR
PEX13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0929-ANR
PEX13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0929-CF
PEX13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0929-NF
PEX13 cDNA ORF Clone, Mouse, C-His tag MG5A0929-CH
PEX13 cDNA ORF Clone, Mouse, N-His tag MG5A0929-NH
PEX13 cDNA ORF Clone, Mouse, C-HA tag MG5A0929-CY
PEX13 cDNA ORF Clone, Mouse, N-HA tag MG5A0929-NY
PEX13 cDNA ORF Clone, Mouse, C-Myc tag MG5A0929-CM
PEX13 cDNA ORF Clone, Mouse, N-Myc tag MG5A0929-NM

PEX13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PEX13 cDNA ORF Clone in Cloning Vector, Human HG15376-G
PEX13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15376-ACGLN
PEX13 cDNA ORF Clone, Human, C-GFPSpark® tag HG15376-ACG
PEX13 cDNA ORF Clone, Human, C-OFPSpark® tag HG15376-ACR
PEX13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15376-CF
PEX13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15376-NF
PEX13 cDNA ORF Clone, Human, C-His tag HG15376-CH
PEX13 cDNA ORF Clone, Human, N-His tag HG15376-NH
PEX13 cDNA ORF Clone, Human, C-HA tag HG15376-CY
PEX13 cDNA ORF Clone, Human, N-HA tag HG15376-NY
PEX13 cDNA ORF Clone, Human, C-Myc tag HG15376-CM
PEX13 cDNA ORF Clone, Human, N-Myc tag HG15376-NM
PEX13 qPCR Primer Pairs, Human HP104000
info info
添加购物车成功! 添加购物车失败!