PDZD11 cDNA ORF Clone, Human, N-HA tag

Cat: HG12188-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDZD11 Reagents
CRO Services
Product recommended

All PDZD11 Reagents
PDZD11 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Human PDZ domain containing 11 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDZD11 cDNA ORF Clone, Human, N-HA tag Alternative Names
AIPP1 cDNA ORF Clone, Human;PDZK11 cDNA ORF Clone, Human;PISP cDNA ORF Clone, Human
PDZD11 Background Information

PDZ domain-containing protein 11, also known as AIPP1a, PISP, PDZD11 and PDZK11, is a cytosolic protein which contains one PDZ (DHR) domain. PDZD11 bears resemblance to members of the MALS / VELIS family of proteins. It contains but one PDZ domain that apparently interacts with the C-terminus of partner proteins. PDZD11 is ubiquitously expressed, and appears to target calcium and copper ATPases to basolateral cell membranes. PDZD11 is a transiently interacting partner of the PMCA b-splice forms that may play a role in their sorting to or from the plasma membrane. Full-length human PDZD11 shares 97% amino acids (aa) identity with mouse PDZD11.

Full Name
PDZ domain containing 11
References
  • Goellner,G.M. et al., 2003, Ann N Y Acad Sci. 986 :461-71.
  • Wolf-Yadlin A., et al., 2007, Proc. Natl. Acad. Sci. USA. 104:5860-5.
  • Heibeck T.H., et al.,2009, J. Proteome Res. 8:3852-61.
  • PDZD11 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PDZD11 cDNA ORF Clone in Cloning Vector, Mouse MG53863-U
    PDZD11 cDNA ORF Clone, Mouse, untagged MG53863-UT
    PDZD11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53863-ACGLN
    PDZD11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53863-ACG
    PDZD11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53863-ANG
    PDZD11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53863-ACR
    PDZD11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53863-ANR
    PDZD11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53863-CF
    PDZD11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53863-NF
    PDZD11 cDNA ORF Clone, Mouse, C-His tag MG53863-CH
    PDZD11 cDNA ORF Clone, Mouse, N-His tag MG53863-NH
    PDZD11 cDNA ORF Clone, Mouse, C-HA tag MG53863-CY
    PDZD11 cDNA ORF Clone, Mouse, N-HA tag MG53863-NY
    PDZD11 cDNA ORF Clone, Mouse, C-Myc tag MG53863-CM
    PDZD11 cDNA ORF Clone, Mouse, N-Myc tag MG53863-NM

    PDZD11 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDZD11 cDNA ORF Clone in Cloning Vector, Human HG12188-G
    PDZD11 cDNA ORF Clone, Human, untagged HG12188-UT
    PDZD11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12188-ACGLN
    PDZD11 cDNA ORF Clone, Human, C-GFPSpark® tag HG12188-ACG
    PDZD11 cDNA ORF Clone, Human, C-OFPSpark® tag HG12188-ACR
    PDZD11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12188-CF
    PDZD11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12188-NF
    PDZD11 cDNA ORF Clone, Human, C-His tag HG12188-CH
    PDZD11 cDNA ORF Clone, Human, N-His tag HG12188-NH
    PDZD11 cDNA ORF Clone, Human, C-HA tag HG12188-CY
    PDZD11 cDNA ORF Clone, Human, C-Myc tag HG12188-CM
    PDZD11 cDNA ORF Clone, Human, N-Myc tag HG12188-NM
    PDZD11 qPCR Primer Pairs, Human HP101818
    info info
    添加购物车成功! 添加购物车失败!