After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PDZD11/PDZK11 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human PDZD11 cDNA Clone Product Information
NCBI RefSeq:BC012996
RefSeq ORF Size:423bp
cDNA Description:Full length Clone DNA of Homo sapiens PDZ domain containing 11 with N terminal Flag tag.
Gene Synonym:PISP, AIPP1, PDZK11, PDZD11
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PDZ domain-containing protein 11, also known as AIPP1a, PISP, PDZD11 and PDZK11, is a cytosolic protein which contains one PDZ (DHR) domain. PDZD11 bears resemblance to members of the MALS / VELIS family of proteins. It contains but one PDZ domain that apparently interacts with the C-terminus of partner proteins. PDZD11 is ubiquitously expressed, and appears to target calcium and copper ATPases to basolateral cell membranes. PDZD11 is a transiently interacting partner of the PMCA b-splice forms that may play a role in their sorting to or from the plasma membrane. Full-length human PDZD11 shares 97% amino acids (aa) identity with mouse PDZD11.

References
  • Goellner,G.M. et al., 2003, Ann N Y Acad Sci. 986 :461-71.
  • Wolf-Yadlin A., et al., 2007, Proc. Natl. Acad. Sci. USA. 104:5860-5.
  • Heibeck T.H., et al.,2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catalog: HG12188-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"