After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PDZD11/PDZK11 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human PDZD11 cDNA Clone Product Information
NCBI RefSeq:BC012996
RefSeq ORF Size:423bp
cDNA Description:Full length Clone DNA of Homo sapiens PDZ domain containing 11 with C terminal His tag.
Gene Synonym:PISP, AIPP1, PDZK11, PDZD11
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

PDZ domain-containing protein 11, also known as AIPP1a, PISP, PDZD11 and PDZK11, is a cytosolic protein which contains one PDZ (DHR) domain. PDZD11 bears resemblance to members of the MALS / VELIS family of proteins. It contains but one PDZ domain that apparently interacts with the C-terminus of partner proteins. PDZD11 is ubiquitously expressed, and appears to target calcium and copper ATPases to basolateral cell membranes. PDZD11 is a transiently interacting partner of the PMCA b-splice forms that may play a role in their sorting to or from the plasma membrane. Full-length human PDZD11 shares 97% amino acids (aa) identity with mouse PDZD11.

References
  • Goellner,G.M. et al., 2003, Ann N Y Acad Sci. 986 :461-71.
  • Wolf-Yadlin A., et al., 2007, Proc. Natl. Acad. Sci. USA. 104:5860-5.
  • Heibeck T.H., et al.,2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catalog: HG12188-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"