PDRG1 cDNA ORF Clone, Human, C-HA tag

Cat: HG14143-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDRG1 Reagents
CRO Services
Product recommended

All PDRG1 Reagents
PDRG1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
402 bp
Description
Full length Clone DNA of Human p53 and DNA-damage regulated 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDRG1 cDNA ORF Clone, Human, C-HA tag Alternative Names
C20orf126 cDNA ORF Clone, Human;PDRG cDNA ORF Clone, Human
PDRG1 Background Information

PDRG1, also known as C20orf126, belongs to the prefoldin subunit beta family. It is predominantly expressed in normal testis and exhibits reduced but detectable expression in other organs. PDRG1 may play a role in chaperone-mediated protein folding. PDRG1 is overexpressed in tumors relative to normal tissues. Its expression is upregulated in multiple malignancies including cancers of the colon, rectum, ovary, lung, stomach, breast and uterus when compared to their respective matched normal tissues. Thus PDRG1 is a high-value novel tumor marker that could play a role in cancer development and/or progression.

Full Name
p53 and DNA-damage regulated 1
References
  • Kim W. et al., 2011, Mol Cell. 44 (2): 325-40.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Jiang L. et al., 2011, Cancer Biol Ther. 11 (6): 567-73.
  • PDRG1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PDRG1 cDNA ORF Clone in Cloning Vector, Rat RG8A0093-U
    PDRG1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0093-ACGLN

    PDRG1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PDRG1 cDNA ORF Clone in Cloning Vector, Mouse MG53711-U
    PDRG1 cDNA ORF Clone, Mouse, untagged MG53711-UT
    PDRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53711-ACGLN
    PDRG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53711-ACG
    PDRG1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53711-ANG
    PDRG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53711-ACR
    PDRG1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53711-ANR
    PDRG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53711-CF
    PDRG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53711-NF
    PDRG1 cDNA ORF Clone, Mouse, C-His tag MG53711-CH
    PDRG1 cDNA ORF Clone, Mouse, N-His tag MG53711-NH
    PDRG1 cDNA ORF Clone, Mouse, C-HA tag MG53711-CY
    PDRG1 cDNA ORF Clone, Mouse, N-HA tag MG53711-NY
    PDRG1 cDNA ORF Clone, Mouse, C-Myc tag MG53711-CM
    PDRG1 cDNA ORF Clone, Mouse, N-Myc tag MG53711-NM

    PDRG1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDRG1 cDNA ORF Clone in Cloning Vector, Human HG14143-G
    PDRG1 cDNA ORF Clone, Human, untagged HG14143-UT
    PDRG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14143-ACGLN
    PDRG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14143-ACG
    PDRG1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14143-ANG
    PDRG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14143-ACR
    PDRG1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14143-ANR
    PDRG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14143-CF
    PDRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14143-NF
    PDRG1 cDNA ORF Clone, Human, C-His tag HG14143-CH
    PDRG1 cDNA ORF Clone, Human, N-His tag HG14143-NH
    PDRG1 cDNA ORF Clone, Human, N-HA tag HG14143-NY
    PDRG1 cDNA ORF Clone, Human, C-Myc tag HG14143-CM
    PDRG1 cDNA ORF Clone, Human, N-Myc tag HG14143-NM
    PDRG1 qPCR Primer Pairs, Human HP102795
    info info
    添加购物车成功! 添加购物车失败!