PDPK1 cDNA ORF Clone, Human, untagged

Cat: HG10681-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDPK1 Reagents
CRO Services
Product recommended

All PDPK1 Reagents
PDPK1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1671 bp
Description
Full length Clone DNA of Human 3-phosphoinositide dependent protein kinase-1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDPK1 cDNA ORF Clone, Human, untagged Alternative Names
PDK1 cDNA ORF Clone, Human;PDPK2 cDNA ORF Clone, Human;PDPK2P cDNA ORF Clone, Human;PRO0461 cDNA ORF Clone, Human
PDPK1 Background Information
Full Name
3-phosphoinositide dependent protein kinase 1

PDPK1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDPK1 cDNA ORF Clone in Cloning Vector, Mouse MG50856-G
PDPK1 cDNA ORF Clone, Mouse, untagged MG50856-UT
PDPK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50856-ACG
PDPK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50856-ACGLN
PDPK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50856-ANG
PDPK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50856-ACR
PDPK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50856-ANR
PDPK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50856-CF
PDPK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50856-NF
PDPK1 cDNA ORF Clone, Mouse, C-His tag MG50856-CH
PDPK1 cDNA ORF Clone, Mouse, N-His tag MG50856-NH
PDPK1 cDNA ORF Clone, Mouse, C-HA tag MG50856-CY
PDPK1 cDNA ORF Clone, Mouse, N-HA tag MG50856-NY
PDPK1 cDNA ORF Clone, Mouse, C-Myc tag MG50856-CM
PDPK1 cDNA ORF Clone, Mouse, N-Myc tag MG50856-NM
PDPK1 qPCR Primer Pairs, Mouse MP200827

PDPK1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDPK1 cDNA ORF Clone in Cloning Vector, Human HG10681-M
PDPK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10681-ACG
PDPK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10681-ACGLN
PDPK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10681-ANG
PDPK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10681-ACR
PDPK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10681-ANR
PDPK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10681-CF
PDPK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10681-NF
PDPK1 cDNA ORF Clone, Human, C-His tag HG10681-CH
PDPK1 cDNA ORF Clone, Human, N-His tag HG10681-NH
PDPK1 cDNA ORF Clone, Human, C-HA tag HG10681-CY
PDPK1 cDNA ORF Clone, Human, N-HA tag HG10681-NY
PDPK1 cDNA ORF Clone, Human, C-Myc tag HG10681-CM
PDPK1 cDNA ORF Clone, Human, N-Myc tag HG10681-NM
PDPK1 qPCR Primer Pairs, Human HP100644
info info
添加购物车成功! 添加购物车失败!