Quick Order

Human PDK3 Gene ORF cDNA clone expression plasmid

  • Human PDK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human PDK3 cDNA Clone Product Information
NCBI RefSeq:NM_005391.4
RefSeq ORF Size:1221bp
cDNA Description:Full length Clone DNA of Homo sapiens pyruvate dehydrogenase kinase, isozyme 3.
Gene Synonym:PDK3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PDK3
Restriction Site:KpnI + XbaI (6.1kb + 1.22kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PDK3 qPCR primers for gene expression analysis, HP100662 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PDK3 Gene Plasmid Map
Human PDK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10723-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"