ERP72 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13333-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ERP72 Reagents
CRO Services
Product recommended

All ERP72 Reagents
ERP72 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1938 bp
Description
Full length Clone DNA of Human protein disulfide isomerase family A, member 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERP72 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ERp-72 cDNA ORF Clone, Human;ERP70 cDNA ORF Clone, Human;ERP72 cDNA ORF Clone, Human
ERP72 Background Information

ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase family. ERP72 is a stress protein and participates in the catalysis of protein-S-S-bond rearrangement. Both of PDIA4 and PDIA3 function as proteases, protein disulfide isomerases, phospholipases or an arrangement of these. ERP72 compose part of a large chaperone multiprotein complex comprising CABP1, DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX.

Full Name
protein disulfide isomerase family A, member 4
References
  • Tsai YC, et al. (2012) Functional proteomics establishes the interaction of SIRT7 with chromatin remodeling complexes and expands its role in regulation of RNA polymerase I transcription. Mol Cell Proteomics. 11(5):60-76.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • ERP72 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ERP72 cDNA ORF Clone in Cloning Vector, Rat RG81061-U
    ERP72 cDNA ORF Clone, Rat, untagged RG81061-UT
    ERP72 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81061-ACGLN
    ERP72 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81061-ACG
    ERP72 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81061-ACR
    ERP72 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81061-CF
    ERP72 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81061-NF
    ERP72 cDNA ORF Clone, Rat, C-His tag RG81061-CH
    ERP72 cDNA ORF Clone, Rat, N-His tag RG81061-NH
    ERP72 cDNA ORF Clone, Rat, C-HA tag RG81061-CY
    ERP72 cDNA ORF Clone, Rat, N-HA tag RG81061-NY
    ERP72 cDNA ORF Clone, Rat, C-Myc tag RG81061-CM
    ERP72 cDNA ORF Clone, Rat, N-Myc tag RG81061-NM
    ERP72 qPCR Primer Pairs, Rat RP301025

    ERP72 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ERP72 cDNA ORF Clone in Cloning Vector, Mouse MG53196-G
    ERP72 cDNA ORF Clone, Mouse, untagged MG53196-UT
    ERP72 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53196-ACGLN
    ERP72 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53196-ACG
    ERP72 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53196-ACR
    ERP72 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53196-CF
    ERP72 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53196-NF
    ERP72 cDNA ORF Clone, Mouse, C-His tag MG53196-CH
    ERP72 cDNA ORF Clone, Mouse, N-His tag MG53196-NH
    ERP72 cDNA ORF Clone, Mouse, C-HA tag MG53196-CY
    ERP72 cDNA ORF Clone, Mouse, N-HA tag MG53196-NY
    ERP72 cDNA ORF Clone, Mouse, C-Myc tag MG53196-CM
    ERP72 cDNA ORF Clone, Mouse, N-Myc tag MG53196-NM

    ERP72 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ERP72 cDNA ORF Clone in Cloning Vector, Human HG13333-G
    ERP72 cDNA ORF Clone, Human, untagged HG13333-UT
    ERP72 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13333-ACGLN
    ERP72 cDNA ORF Clone, Human, C-GFPSpark® tag HG13333-ACG
    ERP72 cDNA ORF Clone, Human, C-OFPSpark® tag HG13333-ACR
    ERP72 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13333-NF
    ERP72 cDNA ORF Clone, Human, C-His tag HG13333-CH
    ERP72 cDNA ORF Clone, Human, N-His tag HG13333-NH
    ERP72 cDNA ORF Clone, Human, C-HA tag HG13333-CY
    ERP72 cDNA ORF Clone, Human, N-HA tag HG13333-NY
    ERP72 cDNA ORF Clone, Human, C-Myc tag HG13333-CM
    ERP72 cDNA ORF Clone, Human, N-Myc tag HG13333-NM
    ERP72 qPCR Primer Pairs, Human HP102038
    info info
    添加购物车成功! 添加购物车失败!