Quick Order

Human PDIA4 ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human PDIA4 cDNA Clone Product Information
NCBI RefSeq:BC000425
RefSeq ORF Size:1938bp
cDNA Description:Full length Clone DNA of Homo sapiens protein disulfide isomerase family A, member 4 with C terminal Flag tag.
Gene Synonym:ERP70, ERP72, ERp-72, PDIA4
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase family. ERP72 is a stress protein and participates in the catalysis of protein-S-S-bond rearrangement. Both of PDIA4 and PDIA3 function as proteases, protein disulfide isomerases, phospholipases or an arrangement of these. ERP72 compose part of a large chaperone multiprotein complex comprising CABP1, DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX.

References
  • Tsai YC, et al. (2012) Functional proteomics establishes the interaction of SIRT7 with chromatin remodeling complexes and expands its role in regulation of RNA polymerase I transcription. Mol Cell Proteomics. 11(5):60-76.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • Size / Price
    Catalog: HG13333-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"