PDE2A cDNA ORF Clone, Human, C-Myc tag

Cat: HG13031-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDE2A Reagents
CRO Services
Product recommended

All PDE2A Reagents
PDE2A cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2826 bp
Description
Full length Clone DNA of Human phosphodiesterase 2A, cGMP-stimulated with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDE2A cDNA ORF Clone, Human, C-Myc tag Alternative Names
CGS-PDE cDNA ORF Clone, Human;cGSPDE cDNA ORF Clone, Human;PDE2A1 cDNA ORF Clone, Human;PED2A4 cDNA ORF Clone, Human
PDE2A Background Information

cGMP-dependent 3',5'-cyclic phosphodiesterase, also known as cyclic GMP-stimulated phosphodiesterase and PDE2A, is a peripheral membrane protein which belongs to the cyclic nucleotide phosphodiesterase family and PDE2 subfamily. Phosphodiesterases (PDEs) comprise a family of enzymes that regulate the levels of cyclic nucleotides, key second messengers that mediate a diverse array of functions. Phosphodiesterases (PDEs) modulate signaling by cyclic nucleotides in diverse processes such as cardiac contractility, platelet aggregation, lipolysis, glycogenolysis, and smooth muscle contraction. PDE2A is an evolutionarily conserved cGMP-stimulated cAMP and cGMP PDE. PDE2A contains two GAF domains. PDE2A is expressed in brain and to a lesser extent in heart, placenta, lung, skeletal muscle, kidney and pancreas. PDE2A is a cyclic nucleotide phosphodiesterase with a dual-specificity for the second messengers cAMP and cGMP, which are key regulators of many important physiological processes. PDE2A is involved in the regulation of blood pressure and fluid homeostasis by the atrial natriuretic peptide (ANP), making PDE2-type enzymes important targets for drug discovery.

Full Name
phosphodiesterase 2A, cGMP-stimulated
References
  • Iffland,A. et al., 2005, Biochemistry. 44 (23):8312-25
  • de Oliveira,S.K. et al., 2007,J Biol Chem. 282 (18):13656-63.
  • Stephenson,D.T. et al., 2009, J Histochem Cytochem. 57 (10):933-49.
  • Russwurm,C. et al., 2009, J Biol Chem. 284 (38):25782-90.
  • info info
    添加购物车成功! 添加购物车失败!