PDCD6 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11589-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDCD6 Reagents
CRO Services
Product recommended

All PDCD6 Reagents
PDCD6 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
366 bp
Description
Full length Clone DNA of Human programmed cell death 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDCD6 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ALG-2 cDNA ORF Clone, Human;ALG2 cDNA ORF Clone, Human;PEF1B cDNA ORF Clone, Human
PDCD6 Background Information
Full Name
programmed cell death 6

PDCD6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDCD6 cDNA ORF Clone in Cloning Vector, Rat RG8A1318-U
PDCD6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1318-ACGLN

PDCD6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDCD6 cDNA ORF Clone in Cloning Vector, Mouse MG5A0026-U
PDCD6 cDNA ORF Clone, Mouse, untagged MG5A0026-UT
PDCD6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0026-ACG
PDCD6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0026-ACGLN
PDCD6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0026-ANG
PDCD6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0026-ACR
PDCD6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0026-ANR
PDCD6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0026-CF
PDCD6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0026-NF
PDCD6 cDNA ORF Clone, Mouse, C-His tag MG5A0026-CH
PDCD6 cDNA ORF Clone, Mouse, N-His tag MG5A0026-NH
PDCD6 cDNA ORF Clone, Mouse, C-HA tag MG5A0026-CY
PDCD6 cDNA ORF Clone, Mouse, N-HA tag MG5A0026-NY
PDCD6 cDNA ORF Clone, Mouse, C-Myc tag MG5A0026-CM
PDCD6 cDNA ORF Clone, Mouse, N-Myc tag MG5A0026-NM

PDCD6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDCD6 cDNA ORF Clone in Cloning Vector, Human HG11589-G
PDCD6 cDNA ORF Clone, Human, untagged HG11589-UT
PDCD6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11589-ACG
PDCD6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11589-ACGLN
PDCD6 cDNA ORF Clone, Human, N-GFPSpark® tag HG11589-ANG
PDCD6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11589-ACR
PDCD6 cDNA ORF Clone, Human, N-OFPSpark® tag HG11589-ANR
PDCD6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11589-CF
PDCD6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11589-NF
PDCD6 cDNA ORF Clone, Human, C-His tag HG11589-CH
PDCD6 cDNA ORF Clone, Human, N-His tag HG11589-NH
PDCD6 cDNA ORF Clone, Human, C-HA tag HG11589-CY
PDCD6 cDNA ORF Clone, Human, N-HA tag HG11589-NY
PDCD6 cDNA ORF Clone, Human, C-Myc tag HG11589-CM
PDCD6 qPCR Primer Pairs, Human HP104877
info info
添加购物车成功! 添加购物车失败!