PDCD10 cDNA ORF Clone, Human, C-His tag

Cat: HG16352-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PDCD10 Reagents
CRO Services
Product recommended

All PDCD10 Reagents
PDCD10 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human programmed cell death 10 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDCD10 cDNA ORF Clone, Human, C-His tag Alternative Names
CCM3 cDNA ORF Clone, Human;TFAR15 cDNA ORF Clone, Human
PDCD10 Background Information
Full Name
programmed cell death 10

PDCD10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDCD10 cDNA ORF Clone in Cloning Vector, Rat RG81404-G

PDCD10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDCD10 cDNA ORF Clone in Cloning Vector, Mouse MG52665-G
PDCD10 cDNA ORF Clone, Mouse, untagged MG52665-UT
PDCD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52665-ACG
PDCD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52665-ACGLN
PDCD10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52665-ANG
PDCD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52665-ACR
PDCD10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52665-ANR
PDCD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52665-CF
PDCD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52665-NF
PDCD10 cDNA ORF Clone, Mouse, C-His tag MG52665-CH
PDCD10 cDNA ORF Clone, Mouse, N-His tag MG52665-NH
PDCD10 cDNA ORF Clone, Mouse, C-HA tag MG52665-CY
PDCD10 cDNA ORF Clone, Mouse, N-HA tag MG52665-NY
PDCD10 cDNA ORF Clone, Mouse, C-Myc tag MG52665-CM
PDCD10 cDNA ORF Clone, Mouse, N-Myc tag MG52665-NM
PDCD10 qPCR Primer Pairs, Mouse MP202536

PDCD10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDCD10 cDNA ORF Clone in Cloning Vector, Human HG16352-G
PDCD10 cDNA ORF Clone, Human, untagged HG16352-UT
PDCD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16352-ACGLN
PDCD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG16352-ACG
PDCD10 cDNA ORF Clone, Human, N-GFPSpark® tag HG16352-ANG
PDCD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG16352-ACR
PDCD10 cDNA ORF Clone, Human, N-OFPSpark® tag HG16352-ANR
PDCD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16352-CF
PDCD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16352-NF
PDCD10 cDNA ORF Clone, Human, N-His tag HG16352-NH
PDCD10 cDNA ORF Clone, Human, C-HA tag HG16352-CY
PDCD10 cDNA ORF Clone, Human, N-HA tag HG16352-NY
PDCD10 cDNA ORF Clone, Human, C-Myc tag HG16352-CM
PDCD10 cDNA ORF Clone, Human, N-Myc tag HG16352-NM
PDCD10 qPCR Primer Pairs, Human HP105104
info info
添加购物车成功! 添加购物车失败!