PCYOX1 cDNA ORF Clone, Human, N-HA tag

Cat: HG13574-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCYOX1 Reagents
CRO Services
Product recommended

All PCYOX1 Reagents
PCYOX1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Description
Full length Clone DNA of Human prenylcysteine oxidase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCYOX1 cDNA ORF Clone, Human, N-HA tag Alternative Names
PCL1 cDNA ORF Clone, Human
PCYOX1 Background Information
Full Name
prenylcysteine oxidase 1

PCYOX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PCYOX1 cDNA ORF Clone in Cloning Vector, Mouse MG52488-G
PCYOX1 cDNA ORF Clone, Mouse, untagged MG52488-UT
PCYOX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52488-ACG
PCYOX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52488-ACGLN
PCYOX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52488-ACR
PCYOX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52488-CF
PCYOX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52488-NF
PCYOX1 cDNA ORF Clone, Mouse, C-His tag MG52488-CH
PCYOX1 cDNA ORF Clone, Mouse, N-His tag MG52488-NH
PCYOX1 cDNA ORF Clone, Mouse, C-HA tag MG52488-CY
PCYOX1 cDNA ORF Clone, Mouse, N-HA tag MG52488-NY
PCYOX1 cDNA ORF Clone, Mouse, C-Myc tag MG52488-CM
PCYOX1 cDNA ORF Clone, Mouse, N-Myc tag MG52488-NM
PCYOX1 qPCR Primer Pairs, Mouse MP202361

PCYOX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PCYOX1 cDNA ORF Clone in Cloning Vector, Human HG13574-G
PCYOX1 cDNA ORF Clone, Human, untagged HG13574-UT
PCYOX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13574-ACGLN
PCYOX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13574-ACG
PCYOX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13574-ACR
PCYOX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13574-CF
PCYOX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13574-NF
PCYOX1 cDNA ORF Clone, Human, C-His tag HG13574-CH
PCYOX1 cDNA ORF Clone, Human, N-His tag HG13574-NH
PCYOX1 cDNA ORF Clone, Human, C-HA tag HG13574-CY
PCYOX1 cDNA ORF Clone, Human, C-Myc tag HG13574-CM
PCYOX1 cDNA ORF Clone, Human, N-Myc tag HG13574-NM
PCYOX1 qPCR Primer Pairs, Human HP102260
info info
添加购物车成功! 添加购物车失败!