PCSK1 cDNA ORF Clone, Human, N-His tag

Cat: HG10129-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCSK1 Reagents
CRO Services
Product recommended

All PCSK1 Reagents
PCSK1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2274 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human proprotein convertase subtilisin/kexin type 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Restriction Sites
KpnI + XbaI(6kb+2.27kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PCSK1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCSK1 cDNA ORF Clone, Human, N-His tag Validated Images
Rhesus CD3d/CD3 delta Gene Plasmid Map 5615
PCSK1 cDNA ORF Clone, Human, N-His tag Alternative Names
BMIQ12 cDNA ORF Clone, Human;NEC1 cDNA ORF Clone, Human;PC1 cDNA ORF Clone, Human;PC3 cDNA ORF Clone, Human;SPC3 cDNA ORF Clone, Human
PCSK1 Background Information

Neuroendocrine convertase 1, also known as Prohormone convertase 1, Proprotein convertase 1, PCSK1 and NEC1, is an enzyme which belongs to the peptidase S8 family and Furin subfamily. PCSK1 is an enzyme that performs the proteolytic cleavage of prohormones to their intermediate (or sometimes completely cleaved) forms. It is present only in neuroendocrine cells such as brain, pituitary and adrenal, and most often cleaves after a pair of basic residues within prohormones but can occasionally cleave after a single arginine. It binds to a protein known as proSAAS, which also represents its endogenous inhibitor. PCSK1 is involved in the processing of hormone and other protein precursors at sites comprised of pairs of basic amino acid residues. PCSK1 substrates include POMC, renin, enkephalin, dynorphin, somatostatin and insulin. Defects in PCSK1 are the cause of proprotein convertase 1 deficiency (PC1 deficiency). PC1 deficiency is characterized by obesity, hypogonadism, hypoadrenalism, reactive hypoglycemia as well as marked small-intestinal absorptive dysfunction. It is due to impaired processing of prohormones.

Full Name
proprotein convertase subtilisin/kexin type 1
References
  • Jackson RS. et al., 2003, J. Clin. Invest. 112:1550-60.
  • Farooqi I.S. et al., 2007, J. Clin. Endocrinol. Metab. 92: 3369-73.
  • Benzinou,M. et al., 2008,Nat Genet. 40 (8):943-5.
  • Benzinou M. et al., 2008, Nat. Genet. 40:943-5.
  • Renström F, et al., 2009, Hum. Mol. Genet. 18 (8): 1489-96.
  • PCSK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PCSK1 cDNA ORF Clone in Cloning Vector, Mouse MG50978-G
    PCSK1 cDNA ORF Clone, Mouse, untagged MG50978-UT
    PCSK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50978-ACGLN
    PCSK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50978-ACG
    PCSK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50978-ANG
    PCSK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50978-ACR
    PCSK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50978-ANR
    PCSK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50978-CF
    PCSK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50978-NF
    PCSK1 cDNA ORF Clone, Mouse, C-His tag MG50978-CH
    PCSK1 cDNA ORF Clone, Mouse, N-His tag MG50978-NH
    PCSK1 cDNA ORF Clone, Mouse, C-HA tag MG50978-CY
    PCSK1 cDNA ORF Clone, Mouse, N-HA tag MG50978-NY
    PCSK1 cDNA ORF Clone, Mouse, C-Myc tag MG50978-CM
    PCSK1 cDNA ORF Clone, Mouse, N-Myc tag MG50978-NM
    PCSK1 qPCR Primer Pairs, Mouse MP200946

    PCSK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PCSK1 cDNA ORF Clone in Cloning Vector, Human HG10129-M
    PCSK1 cDNA ORF Clone, Human, untagged HG10129-UT
    PCSK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10129-ACG
    PCSK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10129-ACGLN
    PCSK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10129-ACR
    PCSK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10129-CF
    PCSK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10129-NF
    PCSK1 cDNA ORF Clone, Human, C-His tag HG10129-CH
    PCSK1 cDNA ORF Clone, Human, C-HA tag HG10129-CY
    PCSK1 cDNA ORF Clone, Human, N-HA tag HG10129-NY
    PCSK1 cDNA ORF Clone, Human, C-Myc tag HG10129-CM
    PCSK1 cDNA ORF Clone, Human, N-Myc tag HG10129-NM
    PCSK1 qPCR Primer Pairs, Human HP100201
    info info
    添加购物车成功! 添加购物车失败!