PCNA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12131-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCNA Reagents
CRO Services
Product recommended

All PCNA Reagents
PCNA cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Human proliferating cell nuclear antigen with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCNA cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ATLD2 cDNA ORF Clone, Human
PCNA Background Information

Proliferating Cell Nuclear Antigen (PCNA) is a protein only expresse in nomal proliferate cells and cancer cells. It is central to both DNA replication and repair. One of the well-established functions for PCNA is its role as the processivity factor for DNA polymerase delta and epsilon. PCNA tethers the polymerase catalytic unit to the DNA template for rapid and processive DNA synthesis. Two forms of PCNA exist in cells: (i) a detergent-insoluble trimeric form stably associated with the replicating forks during S phase and (ii) a soluble form in quiescent cells in G1 and G2 phases. PCNA forms a toroidal trimer in S phase with replication factor-C (RF-C) and DNA in an ATP-dependent manner and enables the loading of DNA polymerase delta and epsilon onto the complex. The close association of PCNA with kinase complexes involved in cell cycle machinery indicates that PCNA has a regulatory role in cell cycle progression. PCNA also participates in the processing of branched intermediates that arise during the lagging strand DNA synthesis.

Full Name
proliferating cell nuclear antigen
References
  • Balajee AS, et al. (2001) Chromatin-bound PCNA complex formation triggered by DNA damage occurs independent of the ATM gene product in human cells. Nucleic Acids Res. 29 (6): 1341-51.
  • Ducoux M, et al. (2001) Mediation of proliferating cell nuclear antigen (PCNA)-dependent DNA replication through a conserved p21(Cip1)-like PCNA-binding motif present in the third subunit of human DNA polymerase delta. J Biol Chem. 276 (52): 49258-66.
  • Tetsuo I, et al. (2002) PCNA clamp facilitates action of DNA cytosine methyltransferase 1 on hemimethylated DNA. Genes Cells. 7(10): 997-1007.
  • PCNA cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    PCNA cDNA ORF Clone in Cloning Vector, Rhesus CG90344-G
    PCNA cDNA ORF Clone, Rhesus, untagged CG90344-UT
    PCNA cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90344-ACG
    PCNA Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90344-ACGLN
    PCNA cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90344-ANG
    PCNA cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90344-ACR
    PCNA cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90344-ANR
    PCNA cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90344-CF
    PCNA cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90344-NF
    PCNA cDNA ORF Clone, Rhesus, C-His tag CG90344-CH
    PCNA cDNA ORF Clone, Rhesus, N-His tag CG90344-NH
    PCNA cDNA ORF Clone, Rhesus, C-HA tag CG90344-CY
    PCNA cDNA ORF Clone, Rhesus, N-HA tag CG90344-NY
    PCNA cDNA ORF Clone, Rhesus, C-Myc tag CG90344-CM
    PCNA cDNA ORF Clone, Rhesus, N-Myc tag CG90344-NM

    PCNA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PCNA cDNA ORF Clone in Cloning Vector, Mouse MG51906-U
    PCNA cDNA ORF Clone, Mouse, untagged MG51906-UT
    PCNA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51906-ACG
    PCNA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51906-ACGLN
    PCNA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51906-ANG
    PCNA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51906-ACR
    PCNA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51906-ANR
    PCNA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51906-CF
    PCNA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51906-NF
    PCNA cDNA ORF Clone, Mouse, C-His tag MG51906-CH
    PCNA cDNA ORF Clone, Mouse, N-His tag MG51906-NH
    PCNA cDNA ORF Clone, Mouse, C-HA tag MG51906-CY
    PCNA cDNA ORF Clone, Mouse, N-HA tag MG51906-NY
    PCNA cDNA ORF Clone, Mouse, C-Myc tag MG51906-CM
    PCNA cDNA ORF Clone, Mouse, N-Myc tag MG51906-NM
    PCNA qPCR Primer Pairs, Mouse MP201779

    PCNA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PCNA cDNA ORF Clone in Cloning Vector, Human HG12131-M
    PCNA cDNA ORF Clone, Human, untagged HG12131-UT
    PCNA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12131-ACGLN
    PCNA cDNA ORF Clone, Human, C-GFPSpark® tag HG12131-ACG
    PCNA cDNA ORF Clone, Human, N-GFPSpark® tag HG12131-ANG
    PCNA cDNA ORF Clone, Human, C-OFPSpark® tag HG12131-ACR
    PCNA cDNA ORF Clone, Human, N-OFPSpark® tag HG12131-ANR
    PCNA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12131-CF
    PCNA cDNA ORF Clone, Human, C-His tag HG12131-CH
    PCNA cDNA ORF Clone, Human, N-His tag HG12131-NH
    PCNA cDNA ORF Clone, Human, C-HA tag HG12131-CY
    PCNA cDNA ORF Clone, Human, N-HA tag HG12131-NY
    PCNA cDNA ORF Clone, Human, C-Myc tag HG12131-CM
    PCNA cDNA ORF Clone, Human, N-Myc tag HG12131-NM
    PCNA qPCR Primer Pairs, Human HP101657
    info info
    添加购物车成功! 添加购物车失败!