PCK2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14310-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PCK2 Reagents

CRO Services

Product recommended


All PCK2 Reagents

PCK2 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1923 bp
Description
Full length Clone DNA of Human phosphoenolpyruvate carboxykinase 2 (mitochondrial) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCK2 cDNA ORF Clone, Human, N-Myc tag Alternative Names

PEPCK cDNA ORF Clone, Human;PEPCK-M cDNA ORF Clone, Human;PEPCK2 cDNA ORF Clone, Human

PCK2 Background Information

Full Name
phosphoenolpyruvate carboxykinase 2 (mitochondrial)

PCK2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PCK2 cDNA ORF Clone in Cloning Vector, Mouse MG53266-U
PCK2 cDNA ORF Clone, Mouse, untagged MG53266-UT
PCK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53266-ACGLN
PCK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53266-ACG
PCK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53266-ANG
PCK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53266-ACR
PCK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53266-ANR
PCK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53266-CF
PCK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53266-NF
PCK2 cDNA ORF Clone, Mouse, C-His tag MG53266-CH
PCK2 cDNA ORF Clone, Mouse, N-His tag MG53266-NH
PCK2 cDNA ORF Clone, Mouse, C-HA tag MG53266-CY
PCK2 cDNA ORF Clone, Mouse, N-HA tag MG53266-NY
PCK2 cDNA ORF Clone, Mouse, C-Myc tag MG53266-CM
PCK2 cDNA ORF Clone, Mouse, N-Myc tag MG53266-NM

PCK2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PCK2 cDNA ORF Clone in Cloning Vector, Human HG14310-G
PCK2 cDNA ORF Clone, Human, untagged HG14310-UT
PCK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14310-ACGLN
PCK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14310-ACG
PCK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14310-ANG
PCK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14310-ACR
PCK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14310-ANR
PCK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14310-CF
PCK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14310-NF
PCK2 cDNA ORF Clone, Human, C-His tag HG14310-CH
PCK2 cDNA ORF Clone, Human, N-His tag HG14310-NH
PCK2 cDNA ORF Clone, Human, C-HA tag HG14310-CY
PCK2 cDNA ORF Clone, Human, N-HA tag HG14310-NY
PCK2 cDNA ORF Clone, Human, C-Myc tag HG14310-CM
PCK2 qPCR Primer Pairs, Human HP102960
info info
添加购物车成功! 添加购物车失败!