PCBD1 cDNA ORF Clone, Human, untagged

Cat: HG14482-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCBD1 Reagents
CRO Services
Product recommended

All PCBD1 Reagents
PCBD1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
315 bp
Description
Full length Clone DNA of Human pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCBD1 cDNA ORF Clone, Human, untagged Alternative Names
DCOH cDNA ORF Clone, Human;PCBD cDNA ORF Clone, Human;PCD cDNA ORF Clone, Human;PHS cDNA ORF Clone, Human
PCBD1 Background Information
Full Name
pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha

PCBD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PCBD1 cDNA ORF Clone in Cloning Vector, Mouse MG53395-U
PCBD1 cDNA ORF Clone, Mouse, untagged MG53395-UT
PCBD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53395-ACG
PCBD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53395-ACGLN
PCBD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53395-ANG
PCBD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53395-ACR
PCBD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53395-ANR
PCBD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53395-CF
PCBD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53395-NF
PCBD1 cDNA ORF Clone, Mouse, C-His tag MG53395-CH
PCBD1 cDNA ORF Clone, Mouse, N-His tag MG53395-NH
PCBD1 cDNA ORF Clone, Mouse, C-HA tag MG53395-CY
PCBD1 cDNA ORF Clone, Mouse, N-HA tag MG53395-NY
PCBD1 cDNA ORF Clone, Mouse, C-Myc tag MG53395-CM
PCBD1 cDNA ORF Clone, Mouse, N-Myc tag MG53395-NM

PCBD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PCBD1 cDNA ORF Clone in Cloning Vector, Human HG14482-G
PCBD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14482-ACG
PCBD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14482-ACGLN
PCBD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14482-ANG
PCBD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14482-ACR
PCBD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14482-ANR
PCBD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14482-CF
PCBD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14482-NF
PCBD1 cDNA ORF Clone, Human, C-His tag HG14482-CH
PCBD1 cDNA ORF Clone, Human, N-His tag HG14482-NH
PCBD1 cDNA ORF Clone, Human, C-HA tag HG14482-CY
PCBD1 cDNA ORF Clone, Human, N-HA tag HG14482-NY
PCBD1 cDNA ORF Clone, Human, C-Myc tag HG14482-CM
PCBD1 cDNA ORF Clone, Human, N-Myc tag HG14482-NM
PCBD1 qPCR Primer Pairs, Human HP103130
info info
添加购物车成功! 添加购物车失败!