Quick Order

Human PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid

  • Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human PARP3 cDNA Clone Product Information
NCBI RefSeq:NM_005485.4
RefSeq ORF Size:1602bp
cDNA Description:Full length Clone DNA of Homo sapiens poly (ADP-ribose) polymerase family, member 3, transcript variant 2.
Gene Synonym:IRT1, ADPRT3, ADPRTL2, ADPRTL3, PADPRT-3, PARP3
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PARP3
Restriction Site:KpnI + XbaI (6.1kb + 1.6kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PARP3 qPCR primers for gene expression analysis, HP101095 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PARP3 Gene Plasmid Map
Human PARP3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human PARP3 transcript variant 2 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
References
  • Loseva O, et al. (2010) PARP-3 is a mono-ADP-ribosylase that activates PARP-1 in the absence of DNA. J Biol Chem. 285(11): 8054-60.
  • Lehtio L, et al. (2009) Structural basis for inhibitor specificity in human poly(ADP-ribose) polymerase-3. J Med Chem. 52(9): 3108-11.
  • Rouleau M, et al. (2009) Assessment of PARP-3 distribution in tissues of cynomolgous monkeys. J Histochem Cytochem. 57(7): 675-85.
  • Rouleau M, et al. (2007) PARP-3 associates with polycomb group bodies and with components of the DNA damage repair machinery. J Cell Biochem. 100(2): 385-401.
  • Augustin A, et al. (2003) PARP-3 localizes preferentially to the daughter centriole and interferes with the G1/S cell cycle progression. J Cell Sci. 116(Pt 8): 1551-62.
  • Size / Price
    Catalog: HG11190-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"