PARP11 cDNA ORF Clone, Human, C-HA tag

Cat: HG12153-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PARP11 Reagents
CRO Services
Product recommended

All PARP11 Reagents
PARP11 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
996 bp
Description
Full length Clone DNA of Human poly (ADP-ribose) polymerase family, member 11 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PARP11 cDNA ORF Clone, Human, C-HA tag Alternative Names
ARTD11 cDNA ORF Clone, Human;C12orf6 cDNA ORF Clone, Human;MIB006 cDNA ORF Clone, Human
PARP11 Background Information
Full Name
poly (ADP-ribose) polymerase family, member 11

PARP11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PARP11 cDNA ORF Clone in Cloning Vector, Mouse MG54734-U
PARP11 cDNA ORF Clone, Mouse, untagged MG54734-UT
PARP11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54734-ACGLN
PARP11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54734-ACG
PARP11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54734-ANG
PARP11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54734-ACR
PARP11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54734-ANR
PARP11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54734-CF
PARP11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54734-NF
PARP11 cDNA ORF Clone, Mouse, C-His tag MG54734-CH
PARP11 cDNA ORF Clone, Mouse, N-His tag MG54734-NH
PARP11 cDNA ORF Clone, Mouse, C-HA tag MG54734-CY
PARP11 cDNA ORF Clone, Mouse, N-HA tag MG54734-NY
PARP11 cDNA ORF Clone, Mouse, C-Myc tag MG54734-CM
PARP11 cDNA ORF Clone, Mouse, N-Myc tag MG54734-NM

PARP11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PARP11 cDNA ORF Clone in Cloning Vector, Human HG12153-G
PARP11 cDNA ORF Clone, Human, untagged HG12153-UT
PARP11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12153-ACGLN
PARP11 cDNA ORF Clone, Human, C-GFPSpark® tag HG12153-ACG
PARP11 cDNA ORF Clone, Human, N-GFPSpark® tag HG12153-ANG
PARP11 cDNA ORF Clone, Human, C-OFPSpark® tag HG12153-ACR
PARP11 cDNA ORF Clone, Human, N-OFPSpark® tag HG12153-ANR
PARP11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12153-CF
PARP11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12153-NF
PARP11 cDNA ORF Clone, Human, C-His tag HG12153-CH
PARP11 cDNA ORF Clone, Human, N-His tag HG12153-NH
PARP11 cDNA ORF Clone, Human, N-HA tag HG12153-NY
PARP11 cDNA ORF Clone, Human, C-Myc tag HG12153-CM
PARP11 cDNA ORF Clone, Human, N-Myc tag HG12153-NM
PARP11 qPCR Primer Pairs, Human HP101808
info info
添加购物车成功! 添加购物车失败!