PARP cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11040-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PARP Reagents
CRO Services
Product recommended

All PARP Reagents
PARP cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3045 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1056 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human poly (ADP-ribose) polymerase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII (two restriction sites) + XbaI (6kb + 0.7kb + 2.39kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PARP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PARP cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human PARP-1/PARP Gene Expression validated Image 1690
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human PARP-1/PARP Gene Plasmid Map 7734
PARP cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ADPRT cDNA ORF Clone, Human;ADPRT1 cDNA ORF Clone, Human;ARTD1 cDNA ORF Clone, Human;pADPRT-1 cDNA ORF Clone, Human;PARP cDNA ORF Clone, Human;PARP-1 cDNA ORF Clone, Human;PPOL cDNA ORF Clone, Human
PARP Background Information

Poly (ADP-ribose) polymerase 1(PRAP1), also known as NAD(+) ADP-ribosyltransferase 1(ADPRT), is a chromatin-associated enzyme which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The ADP-D-ribosyl group of NAD+ is transferred to an acceptor carboxyl group on a histone or the enzyme itself, and further ADP-ribosyl groups are transferred to the 2'-position of the terminal adenosine moiety, building up a polymer with an average chain length of 20-30 units. The poly(ADP-ribosyl)ation modification is critical for a wide range of processes, including DNA repair, regulation of chromosome structure, transcriptional regulation, mitosis and apoptosis. PARP1 is demonstrateed to mediate the poly(ADP-ribose) ation of APLF (aprataxin PNK-like factor) and CHFR (checkpoint protein with FHA and RING domains), two representative proteins involved in the DNA damage response and checkpoint regulation. Further, It has been suggested that DNA-dependent protein kinase (DNA-PK), another component of DNA repair, suppresses PARP activity, probably through direct binding and/or sequestration of DNA-ends which serve as an important stimulator for both enzymes. PARP1 inhibitors is thus proposed as a targeted cancer therapy for recombination deficient cancers, such as BRCA2 tumors.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
poly (ADP-ribose) polymerase 1
References
  • Malanga M. et al., 1998, J Biol Chem. 273: 11839-11843.
  • Ariumi Y. et al., 1999, Oncogene. 18: 4616-4625.
  • Helleday T. et al., 2005, Cell Cycle. 4: 1176-1178.
  • Ahell I. et al., 2008, Nature. 451: 81-85.
  • PARP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PARP cDNA ORF Clone in Cloning Vector, Mouse MG50753-G
    PARP cDNA ORF Clone, Mouse, untagged MG50753-UT
    PARP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50753-ACG
    PARP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50753-ACGLN
    PARP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50753-ANG
    PARP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50753-ACR
    PARP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50753-ANR
    PARP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50753-CF
    PARP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50753-NF
    PARP cDNA ORF Clone, Mouse, C-His tag MG50753-CH
    PARP cDNA ORF Clone, Mouse, N-His tag MG50753-NH
    PARP cDNA ORF Clone, Mouse, C-HA tag MG50753-CY
    PARP cDNA ORF Clone, Mouse, N-HA tag MG50753-NY
    PARP cDNA ORF Clone, Mouse, C-Myc tag MG50753-CM
    PARP cDNA ORF Clone, Mouse, N-Myc tag MG50753-NM
    PARP qPCR Primer Pairs, Mouse MP200728

    PARP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PARP cDNA ORF Clone in Cloning Vector, Human HG11040-M
    PARP cDNA ORF Clone, Human, untagged HG11040-UT
    PARP cDNA ORF Clone, Human, C-GFPSpark® tag HG11040-ACG
    PARP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11040-ACGLN
    PARP cDNA ORF Clone, Human, N-GFPSpark® tag HG11040-ANG
    PARP cDNA ORF Clone, Human, C-OFPSpark® tag HG11040-ACR
    PARP cDNA ORF Clone, Human, N-OFPSpark® tag HG11040-ANR
    PARP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11040-NF
    PARP cDNA ORF Clone, Human, C-His tag HG11040-CH
    PARP cDNA ORF Clone, Human, N-His tag HG11040-NH
    PARP cDNA ORF Clone, Human, C-HA tag HG11040-CY
    PARP cDNA ORF Clone, Human, N-HA tag HG11040-NY
    PARP cDNA ORF Clone, Human, C-Myc tag HG11040-CM
    PARP cDNA ORF Clone, Human, N-Myc tag HG11040-NM
    PARP qPCR Primer Pairs, Human HP100996
    info info
    添加购物车成功! 添加购物车失败!