After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PAPPA2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human PAPPA2 cDNA Clone Product Information
NCBI RefSeq:NM_020318.2
RefSeq ORF Size:5376bp
cDNA Description:Full length Clone DNA of Homo sapiens pappalysin 2 , transcript variant 1 with C terminal His tag.
Gene Synonym:PAPPE, PLAC3, PAPP-A2
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Pappalysin-2/PAPP-A2 is the second member of the pappalysin family of metzincin superfamily, of which PAPP-A is the first member. There is no homology between the prepro-peptides of PAPP-A and PAPP-A2, but 46% of the residues of mature PAPP-A are also present in mature PAPP-A2. PAPP-A specifically cleaves insulin-like growth factor-binding protein(IGFBP)-4, one of six known modulators of IGF-I and –II, whereas PAPP-A2 specifically cleaved IGFBP-5 at one site, between Ser-143 and Lys-144. In contrast to the cleavage of IGFBP-4 by PAPP-A that strictly requires the presence of IGF, the cleavage of IGFBP-5 by PAPP-A2 was IGF-independent. Recent data firmly establish PAPP-A and IGFBP-4 as an important functional pair in several systems. Because of its close relationship with PAPP-A, both structurally and functionally, PAPP-A2 is a likely candidate for IGFBP-5 proteinase in many tissues and conditioned media where IGFBP-5 proteolysis has been reported.

References
  • Lisbeth S Laursen. et al., 2002, Vol. 277 (49): 47225-34.
  • Michael T Overgaard. et al., 2001, The Journal of Biological Chemistry. 276 (24): 21849-53.
  • Size / Price
    Catalog: HG10528-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"