PALM/Paralemmin cDNA ORF Clone, Human, N-HA tag

Cat: HG14774-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PALM/Paralemmin Reagents
CRO Services
Product recommended

All PALM/Paralemmin Reagents
PALM/Paralemmin cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1164 bp
Description
Full length Clone DNA of Human paralemmin with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PALM/Paralemmin Background Information
Full Name
paralemmin

PALM/Paralemmin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PALM/Paralemmin cDNA ORF Clone in Cloning Vector, Mouse MG51791-G
PALM/Paralemmin cDNA ORF Clone, Mouse, untagged MG51791-UT
PALM/Paralemmin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51791-ACGLN
PALM/Paralemmin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51791-ACG
PALM/Paralemmin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51791-ANG
PALM/Paralemmin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51791-ACR
PALM/Paralemmin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51791-ANR
PALM/Paralemmin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51791-CF
PALM/Paralemmin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51791-NF
PALM/Paralemmin cDNA ORF Clone, Mouse, C-His tag MG51791-CH
PALM/Paralemmin cDNA ORF Clone, Mouse, N-His tag MG51791-NH
PALM/Paralemmin cDNA ORF Clone, Mouse, C-HA tag MG51791-CY
PALM/Paralemmin cDNA ORF Clone, Mouse, N-HA tag MG51791-NY
PALM/Paralemmin cDNA ORF Clone, Mouse, C-Myc tag MG51791-CM
PALM/Paralemmin cDNA ORF Clone, Mouse, N-Myc tag MG51791-NM
PALM/Paralemmin qPCR Primer Pairs, Mouse MP201664

PALM/Paralemmin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PALM/Paralemmin cDNA ORF Clone in Cloning Vector, Human HG14774-G
PALM/Paralemmin cDNA ORF Clone, Human, untagged HG14774-UT
PALM/Paralemmin cDNA ORF Clone, Human, C-GFPSpark® tag HG14774-ACG
PALM/Paralemmin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14774-ACGLN
PALM/Paralemmin cDNA ORF Clone, Human, C-OFPSpark® tag HG14774-ACR
PALM/Paralemmin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14774-CF
PALM/Paralemmin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14774-NF
PALM/Paralemmin cDNA ORF Clone, Human, C-His tag HG14774-CH
PALM/Paralemmin cDNA ORF Clone, Human, N-His tag HG14774-NH
PALM/Paralemmin cDNA ORF Clone, Human, C-HA tag HG14774-CY
PALM/Paralemmin cDNA ORF Clone, Human, C-Myc tag HG14774-CM
PALM/Paralemmin cDNA ORF Clone, Human, N-Myc tag HG14774-NM
PALM/Paralemmin qPCR Primer Pairs, Human HP103407
info info
添加购物车成功! 添加购物车失败!