PAK7 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10859-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PAK7 Reagents
CRO Services
Product recommended

All PAK7 Reagents
PAK7 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2160 bp
Description
Full length Clone DNA of Human p21 protein (Cdc42/Rac)-activated kinase 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAK7 cDNA ORF Clone, Human, N-Myc tag Alternative Names
PAK5 cDNA ORF Clone, Human
PAK7 Background Information
Full Name
p21 protein (Cdc42/Rac)-activated kinase 7

PAK7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PAK7 cDNA ORF Clone in Cloning Vector, Mouse MG50867-G
PAK7 cDNA ORF Clone, Mouse, untagged MG50867-UT
PAK7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50867-ACG
PAK7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50867-ACGLN
PAK7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50867-ANG
PAK7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50867-ACR
PAK7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50867-ANR
PAK7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50867-CF
PAK7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50867-NF
PAK7 cDNA ORF Clone, Mouse, C-His tag MG50867-CH
PAK7 cDNA ORF Clone, Mouse, N-His tag MG50867-NH
PAK7 cDNA ORF Clone, Mouse, C-HA tag MG50867-CY
PAK7 cDNA ORF Clone, Mouse, N-HA tag MG50867-NY
PAK7 cDNA ORF Clone, Mouse, C-Myc tag MG50867-CM
PAK7 cDNA ORF Clone, Mouse, N-Myc tag MG50867-NM
PAK7 qPCR Primer Pairs, Mouse MP200838

PAK7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PAK7 cDNA ORF Clone in Cloning Vector, Human HG10859-G
PAK7 cDNA ORF Clone, Human, untagged HG10859-UT
PAK7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10859-ACGLN
PAK7 cDNA ORF Clone, Human, C-GFPSpark® tag HG10859-ACG
PAK7 cDNA ORF Clone, Human, N-GFPSpark® tag HG10859-ANG
PAK7 cDNA ORF Clone, Human, C-OFPSpark® tag HG10859-ACR
PAK7 cDNA ORF Clone, Human, N-OFPSpark® tag HG10859-ANR
PAK7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10859-CF
PAK7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10859-NF
PAK7 cDNA ORF Clone, Human, C-His tag HG10859-CH
PAK7 cDNA ORF Clone, Human, N-His tag HG10859-NH
PAK7 cDNA ORF Clone, Human, C-HA tag HG10859-CY
PAK7 cDNA ORF Clone, Human, N-HA tag HG10859-NY
PAK7 cDNA ORF Clone, Human, C-Myc tag HG10859-CM
PAK7 qPCR Primer Pairs, Human HP100752
info info
添加购物车成功! 添加购物车失败!