PAK3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11532-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PAK3 Reagents
CRO Services

All PAK3 Reagents
PAK3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1635 bp
Description
Full length Clone DNA of Human p21 protein (Cdc42/Rac)-activated kinase 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAK3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
bPAK cDNA ORF Clone, Human;CDKN1A cDNA ORF Clone, Human;hPAK3 cDNA ORF Clone, Human;MRX30 cDNA ORF Clone, Human;MRX47 cDNA ORF Clone, Human;OPHN3 cDNA ORF Clone, Human;PAK3beta cDNA ORF Clone, Human
PAK3 Background Information

PAK3 is a member of PAK proteins, a family of serine/threonine p21-activating kinases, serve as effectors of small Rho GTPases Cdc42 and RAC and have been implicated in a wide range of biological activities. There are six mammalian PAKs which can be divided into two groups: group I PAKs (PAK1-3) and group II PAKs (PAK4-6). Although the two PAK groups are architecturally similar there are differences in their mode of regulation suggesting their cellular functions are likely to be different. Group I p21-activated kinases (PAK1/2/3) is demonstrated as ERK3/ERK4 activation loop kinases. It has been shown that group I PAKs phosphorylate ERK3 and ERK4 on Ser-189 and Ser-186, respectively, both in vitro and in vivo, and that expression of activated Rac1 augments this response. Besides regulation enzymatic activation of ERK3/ERK4, PAKs can also play roles in downstream activation of MAP kinase-activated protein kinase 5 (MK5) in vivo. Thus, the  group I PAKs act as upstream activators of ERK3 and ERK4 and unravel a novel PAK-ERK3/ERK4-MK5 signaling pathway. In clinical, PAK has been proposed as a potential therapeutic target in schwannomas.

Full Name
p21 protein (Cdc42/Rac)-activated kinase 3
References
  • Whale A, et al. (2011) Signalling to cancer cell invasion through PAK family kinases. Front Biosci. 16: 849-64.
  • Deleris P, et al. (2011) Activation loop phosphorylation of ERK3/ERK4 by group I p21-activated kinases (PAKs) defines a novel PAK-ERK3/4-MAPK-activated protein kinase 5 signaling pathway. J Biol Chem. 286 (8): 6470-8.
  • Canet B, et al. (2011) Ovarian clear cell carcinomas: RHO GTPases may contribute to explain their singular biologic behavior. Hum Pathol. 42 (6): 833-9.
  • info info
    添加购物车成功! 添加购物车失败!