Quick Order

Human PAK3 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human PAK3 cDNA Clone Product Information
    NCBI RefSeq:NM_001128166.1
    RefSeq ORF Size:1635bp
    cDNA Description:Full length Clone DNA of Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 3 with N terminal Myc tag.
    Gene Synonym:bPAK, MRX30, MRX47, OPHN3, hPAK3, CDKN1A, PAK3beta, PAK3
    Species:Human
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PAK3 qPCR primers for gene expression analysis, HP101401 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    PAK3 is a member of PAK proteins, a family of serine/threonine p21-activating kinases, serve as effectors of small Rho GTPases Cdc42 and RAC and have been implicated in a wide range of biological activities. There are six mammalian PAKs which can be divided into two groups: group I PAKs (PAK1-3) and group II PAKs (PAK4-6). Although the two PAK groups are architecturally similar there are differences in their mode of regulation suggesting their cellular functions are likely to be different. Group I p21-activated kinases (PAK1/2/3) is demonstrated as ERK3/ERK4 activation loop kinases. It has been shown that group I PAKs phosphorylate ERK3 and ERK4 on Ser-189 and Ser-186, respectively, both in vitro and in vivo, and that expression of activated Rac1 augments this response. Besides regulation enzymatic activation of ERK3/ERK4, PAKs can also play roles in downstream activation of MAP kinase-activated protein kinase 5 (MK5) in vivo. Thus, the  group I PAKs act as upstream activators of ERK3 and ERK4 and unravel a novel PAK-ERK3/ERK4-MK5 signaling pathway. In clinical, PAK has been proposed as a potential therapeutic target in schwannomas.

    References
  • Whale A, et al. (2011) Signalling to cancer cell invasion through PAK family kinases. Front Biosci. 16: 849-64.
  • Deleris P, et al. (2011) Activation loop phosphorylation of ERK3/ERK4 by group I p21-activated kinases (PAKs) defines a novel PAK-ERK3/4-MAPK-activated protein kinase 5 signaling pathway. J Biol Chem. 286 (8): 6470-8.
  • Canet B, et al. (2011) Ovarian clear cell carcinomas: RHO GTPases may contribute to explain their singular biologic behavior. Hum Pathol. 42 (6): 833-9.
  • Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"