Text Size:AAA

Human PAD4/PADI4 Gene ORF cDNA clone expression plasmid

  • Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human PADI4 cDNA Clone Product Information
NCBI RefSeq:NM_012387.2
RefSeq ORF Size:1992bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidyl arginine deiminase, type I V.
Gene Synonym:PAD, PAD4, PDI4, PDI5, PADI5, PADI4
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PADI4
Restriction Site:KpnI + XbaI (6.1kb + 1.99kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations 245 T/C, 349 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PADI4 qPCR primers for gene expression analysis, HP101112 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PADI4 Gene Plasmid Map
Human PADI4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Protein-arginine deiminase type-4, also known as HL-60 PAD, Peptidylarginine deiminase IV, Protein-arginine deiminase type I V and PADI4, is a cytoplasm and nucleus protein which belongs to the protein arginine deiminase family. PADI4 is expressed in CD34+ stem cells in normal tissues, and many more CD34+ cells expressing PADI4 are present in tumour tissues. PADI4 post-translationally converts peptidylarginine to citrulline, a process called citrullination. Studies have demonstrated the high expression of PADI4 in various malignant tumour tissues. PADI4 is also expressed at high levels in the blood of patients with some malignant tumours. Citrullination of histone, cytokeratin, antithrombin and fibronectin have been confirmed to be involved in abnormal apoptosis, high coagulation, and disordered cell proliferation and differentiation, all of which are main features of malignant tumours. PADI4 may play an important role in tumourigenesis. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures.

References
  • Nakashima K. et al.,1999, J. Biol. Chem. 274: 27786-92.
  • Suzuki A. et al., 2003, Nat. Genet. 34:395-402.
  • Nakayama-Hamada M. et al., 2005, Biochem. Biophys. Res. Commun. 327:192-200.
  • Chang, X. et al., 2010, Cancer Cell Int  10:7.
  • Size / Price
    Catalog: HG11072-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"