P4HA2 cDNA ORF Clone, Human, C-HA tag

Cat: HG13577-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All P4HA2 Reagents
CRO Services
Product recommended

All P4HA2 Reagents
P4HA2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1602 bp
Description
Full length Clone DNA of Human prolyl 4-hydroxylase, alpha polypeptide II with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

P4HA2 Background Information
Full Name
prolyl 4-hydroxylase, alpha polypeptide II

P4HA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
P4HA2 cDNA ORF Clone in Cloning Vector, Mouse MG53632-U
P4HA2 cDNA ORF Clone, Mouse, untagged MG53632-UT
P4HA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53632-ACG
P4HA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53632-ACGLN
P4HA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53632-ACR
P4HA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53632-CF
P4HA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53632-NF
P4HA2 cDNA ORF Clone, Mouse, C-His tag MG53632-CH
P4HA2 cDNA ORF Clone, Mouse, N-His tag MG53632-NH
P4HA2 cDNA ORF Clone, Mouse, C-HA tag MG53632-CY
P4HA2 cDNA ORF Clone, Mouse, N-HA tag MG53632-NY
P4HA2 cDNA ORF Clone, Mouse, C-Myc tag MG53632-CM
P4HA2 cDNA ORF Clone, Mouse, N-Myc tag MG53632-NM

P4HA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
P4HA2 cDNA ORF Clone in Cloning Vector, Human HG13577-G
P4HA2 cDNA ORF Clone, Human, untagged HG13577-UT
P4HA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13577-ACGLN
P4HA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13577-ACG
P4HA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13577-ACR
P4HA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13577-CF
P4HA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13577-NF
P4HA2 cDNA ORF Clone, Human, C-His tag HG13577-CH
P4HA2 cDNA ORF Clone, Human, N-His tag HG13577-NH
P4HA2 cDNA ORF Clone, Human, N-HA tag HG13577-NY
P4HA2 cDNA ORF Clone, Human, C-Myc tag HG13577-CM
P4HA2 cDNA ORF Clone, Human, N-Myc tag HG13577-NM
P4HA2 qPCR Primer Pairs, Human HP102263
info info
添加购物车成功! 添加购物车失败!