Quick Order

Human OXSR1/OSR1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human OXSR1 cDNA Clone Product Information
    NCBI RefSeq:NM_005109.2
    RefSeq ORF Size:1584bp
    cDNA Description:Full length Clone DNA of Homo sapiens oxidative-stress responsive 1.
    Gene Synonym:OSR1, KIAA1101, OXSR1
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with OXSR1 qPCR primers for gene expression analysis, HP100665 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Oxidative stress-responsive 1 protein (OXSR1), also known as Serine/threonine-protein kinase OSR1, is a member of the Ser/Thr protein kinase family of proteins. OXSR1 regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. OXSR1 is a 58 kDa protein of 527 amino acids that is widely expressed in mammalian tissues and cell lines. The amino acid (aa) sequence of the predicted OXSR1 protein is 39% identical to that of human SOK1. Of potential regulators surveyed, endogenous OXSR1 is activated only by osmotic stresses, notably sorbitol and to a lesser extent NaCl. OXSR1 did not increase the activity of coexpressed JNK, nor did it activate three other MAPKs, p38, ERK2, and ERK5. Phosphorylation by OXSR1 modulates the G protein sensitivity of PAK isoforms. The OXSR1 and SPAK are key enzymes in a signalling cascade regulating the activity of Na+/K+/2Cl- co-transporters (NKCCs) in response to osmotic stress. Both kinases have a conserved carboxy-terminal (CCT) domain, which recognizes a unique peptide (Arg-Phe-Xaa-Val) motif. The OXSR1 and SPAK kinases specifically recognize their upstream activators and downstream substrates.

    Size / Price
    Catalog: HG10727-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"