OXSM cDNA ORF Clone, Human, N-Myc tag

Cat: HG14915-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OXSM Reagents
CRO Services
Product recommended

All OXSM Reagents
OXSM cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1380 bp
Description
Full length Clone DNA of Human 3-oxoacyl-ACP synthase, mitochondrial with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OXSM cDNA ORF Clone, Human, N-Myc tag Alternative Names
FASN2D cDNA ORF Clone, Human;KASI cDNA ORF Clone, Human;KS cDNA ORF Clone, Human
OXSM Background Information
Full Name
3-oxoacyl-ACP synthase, mitochondrial

OXSM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OXSM cDNA ORF Clone in Cloning Vector, Mouse MG5A5812-U
OXSM cDNA ORF Clone, Mouse, untagged MG5A5812-UT
OXSM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5812-ACGLN
OXSM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5812-ACG
OXSM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5812-ANG
OXSM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5812-ACR
OXSM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5812-ANR
OXSM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5812-CF
OXSM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5812-NF
OXSM cDNA ORF Clone, Mouse, C-His tag MG5A5812-CH
OXSM cDNA ORF Clone, Mouse, N-His tag MG5A5812-NH
OXSM cDNA ORF Clone, Mouse, C-HA tag MG5A5812-CY
OXSM cDNA ORF Clone, Mouse, N-HA tag MG5A5812-NY
OXSM cDNA ORF Clone, Mouse, C-Myc tag MG5A5812-CM
OXSM cDNA ORF Clone, Mouse, N-Myc tag MG5A5812-NM

OXSM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OXSM cDNA ORF Clone in Cloning Vector, Human HG14915-G
OXSM cDNA ORF Clone, Human, untagged HG14915-UT
OXSM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14915-ACGLN
OXSM cDNA ORF Clone, Human, C-GFPSpark® tag HG14915-ACG
OXSM cDNA ORF Clone, Human, N-GFPSpark® tag HG14915-ANG
OXSM cDNA ORF Clone, Human, C-OFPSpark® tag HG14915-ACR
OXSM cDNA ORF Clone, Human, N-OFPSpark® tag HG14915-ANR
OXSM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14915-CF
OXSM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14915-NF
OXSM cDNA ORF Clone, Human, C-His tag HG14915-CH
OXSM cDNA ORF Clone, Human, N-His tag HG14915-NH
OXSM cDNA ORF Clone, Human, C-HA tag HG14915-CY
OXSM cDNA ORF Clone, Human, N-HA tag HG14915-NY
OXSM cDNA ORF Clone, Human, C-Myc tag HG14915-CM
OXSM qPCR Primer Pairs, Human HP103544
info info
添加购物车成功! 添加购物车失败!