OSTM1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10913-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OSTM1 Reagents
CRO Services
Product recommended

All OSTM1 Reagents
OSTM1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Human osteopetrosis associated transmembrane protein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OSTM1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
GIPN cDNA ORF Clone, Human;GL cDNA ORF Clone, Human;HSPC019 cDNA ORF Clone, Human;OPTB5 cDNA ORF Clone, Human
OSTM1 Background Information

Osteopetrosis-associated transmembrane protein 1 (OSTM1) is a Single-pass type I  membrane protein. It is expressed in many hematopoietic cells of the myeloid and lymphoid B- and T-lineages. The analysis of OSTM1 association with CLCN7 demonstrated that OSTM1 requires CLCN7 to localize to lysosomes, whereas the formation of a CLCN7-OSTM1 complex is required to stabilize CLCN7. The researches found that OSTM1 plays a major role in myelopoiesis and lymphopoiesis and provided evidence of a crosstalk mechanism between hematopoietic cells for osteoclast activation. Thus, OSTM1 has a important role in osteoclast function and activation. The loss of function of OSTM1 results in deregulation of multiple hematopoietic lineages in addition to osteoclast lineage, OSTM1-defect patients display the most severe recessive osteopetrotic phenotype and die at early ages. Furthermore, it is suggested that OSTM1 has a primary role in neural development not related to lysosomal dysfunction. The canonical Wnt/beta-catenin signaling pathway may be a molecular basis for OSTM1 mutations and severe autosomal recessive osteopetrosis (ARO).

Full Name
osteopetrosis associated transmembrane protein 1
References

1.  Chalhoub, N. et al., 2003, Nat Med. 9 (4): 399-406.

2.  Quarello, P. et al., 2004, J Bone Miner Res. 19 (7): 1194-1199.

3.  Lange, PF. et al., 2006, Nature. 440 (7081): 220-223

4.  Maranda, B. et al., 2008, J Bone Miner Res. 23 (2): 296-300.

5.  Feigin, ME.et al., 2008, Cell Signal. 20 (5): 949-957.  

6.  Pata, M.et al., 2008, J Biol Chem. 283 (45): 30522-30530. 

OSTM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OSTM1 cDNA ORF Clone in Cloning Vector, Mouse MG51952-G
OSTM1 cDNA ORF Clone, Mouse, untagged MG51952-UT
OSTM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51952-ACGLN
OSTM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51952-ACG
OSTM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51952-ACR
OSTM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51952-CF
OSTM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51952-NF
OSTM1 cDNA ORF Clone, Mouse, C-His tag MG51952-CH
OSTM1 cDNA ORF Clone, Mouse, N-His tag MG51952-NH
OSTM1 cDNA ORF Clone, Mouse, C-HA tag MG51952-CY
OSTM1 cDNA ORF Clone, Mouse, N-HA tag MG51952-NY
OSTM1 cDNA ORF Clone, Mouse, C-Myc tag MG51952-CM
OSTM1 cDNA ORF Clone, Mouse, N-Myc tag MG51952-NM
OSTM1 qPCR Primer Pairs, Mouse MP201825

OSTM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OSTM1 cDNA ORF Clone in Cloning Vector, Human HG10913-M
OSTM1 cDNA ORF Clone, Human, untagged HG10913-UT
OSTM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10913-ACG
OSTM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10913-ACGLN
OSTM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10913-ACR
OSTM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10913-CF
OSTM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10913-NF
OSTM1 cDNA ORF Clone, Human, C-His tag HG10913-CH
OSTM1 cDNA ORF Clone, Human, N-His tag HG10913-NH
OSTM1 cDNA ORF Clone, Human, C-HA tag HG10913-CY
OSTM1 cDNA ORF Clone, Human, N-HA tag HG10913-NY
OSTM1 cDNA ORF Clone, Human, C-Myc tag HG10913-CM
OSTM1 qPCR Primer Pairs, Human HP100796
info info
添加购物车成功! 添加购物车失败!