Quick Order

Human OSMR / IL-31RB ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human OSMR cDNA Clone Product Information
NCBI RefSeq:NM_003999.1
RefSeq ORF Size:2940bp
cDNA Description:Full length Clone DNA of Homo sapiens oncostatin M receptor1 with C terminal HA tag.
Gene Synonym:OSMRB, MGC75127, MGC150626, MGC150627,
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Oncostatin-M specific receptor subunit beta also known as the oncostatin M receptor (OSMR) and Interleukin-31 receptor subunit beta (IL-31RB), is one of the receptor proteins for oncostatin M. OSMR is a member of the type I cytokine receptor family. IL-31RB/OSMR heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in IL-31RB/OSMR have been associated with familial primary localized cutaneous amyloidosis. Defects in IL-31RB/OSMR are the cause of amyloidosis primary localized cutaneous type 1 (PLCA1), also known as familial lichen amyloidosis or familial cutaneous lichen amyloidosis. PLCA1 is a hereditary primary amyloidosis characterized by localized cutaneous amyloid deposition. This condition usually presents with itching (especially on the lower legs) and visible changes of skin hyperpigmentation and thickening (lichenification) that may be exacerbated by chronic scratching and rubbing. The amyloid deposits probably reflect a combination of degenerate keratin filaments, serum amyloid P component, and deposition of immunoglobulins.

References
  • Arita K, et al.. (2008) Oncostatin M Receptor-β Mutations Underlie Familial Primary Localized Cutaneous Amyloidosis. Am J Hum. Genet. 82 (1): 73-80.
  • Malaval L, et al.. (2005) GP130/OSMR is the only LIF/IL-6 family receptor complex to promote osteoblast differentiation of calvaria progenitors. J Cell Physiol. 204(2): 585-93.
  • Lin MW, et al.. (2010) Novel IL31RA gene mutation and ancestral OSMR mutant allele in familial primary cutaneous amyloidosis. Eur J Hum Genet. 18(1): 26-32.
  • Size / Price
    Catalog: HG11226-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"