Quick Order

Human Oncostatin M/OSM Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human OSM cDNA Clone Product Information
NCBI RefSeq:NM_020530.3
RefSeq ORF Size:759bp
cDNA Description:Full length Clone DNA of Homo sapiens oncostatin M with C terminal His tag.
Gene Synonym:MGC20461, OSM
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with OSM qPCR primers for gene expression analysis, HP100481 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Oncostatin M (OSM) is a glycoprotein belonging to the interleukin-6 family of cytokines that has functions mainly in cell growth. Oncostatin M (OSM) is considered as a pleiotropic cytokine that signals through cell surface receptors typeⅠand typeⅡ both of which share the similarity of containing protein gp130 and takes part in many biometabolism processes including liver development, haematopoeisis, inflammation, bone formation and destruction and possibly CNS development. Oncostatin M (OSM) was previoustly identified by its ability to inhibit the growth of cells from melanoma and other solid tumors. It also has been reported that OSM, like LIF, IL-6 and G-CSF, has the ability to inhibit the proliferation of murine M1 myeloid leukemic cells and can induce their differentiation into macrophage-like cells. The human form of OSM is insensitive between pH2 and 11 and resistant to heating for one hour at 56 degree but is not stable at 90 degrees. The human OSM is produced as a precursor containing 252 amino acids, whose first 25 amino acids function as a secretory signal peptide and which on removal yields the soluble 227 amino acid pro-OSM. Removal of the C-teminal most 31 amino acids produces the fully active 196 residue form.

References
  • Tanaka M, et al. (2003) Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol. Reviews of Physiology, Biochemistry and Pharmacology. 149: 39-52.
  • Auguste P, et al. (1997) Signaling of type II oncostatin M receptor. J Biol Chem. 272 (25): 15760-4.
  • Zarling JM, et al. (1986). Oncostatin M: a growth regulator produced by differentiated histiocytic lymphoma cells. Proc Natl Acad Sci. 83 (24): 9739-43.
  • Size / Price
    Catalog: HG10452-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"