Periostin cDNA ORF Clone, Human, N-Myc tag

Cat: HG10299-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Periostin Reagents
CRO Services
Product recommended

All Periostin Reagents
Periostin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2256 bp
Description
Full length Clone DNA of Human periostin, osteoblast specific factor, transcript variant 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Periostin cDNA ORF Clone, Human, N-Myc tag Alternative Names
OSF-2 cDNA ORF Clone, Human;OSF2 cDNA ORF Clone, Human;PDLPOSTN cDNA ORF Clone, Human;periostin cDNA ORF Clone, Human;PN cDNA ORF Clone, Human
Periostin Background Information

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

Full Name
periostin, osteoblast specific factor
References
  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Periostin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Periostin cDNA ORF Clone in Cloning Vector, Mouse MG50450-M
    Periostin cDNA ORF Clone, Mouse, untagged MG50450-UT
    Periostin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50450-ACGLN
    Periostin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50450-ACG
    Periostin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50450-ACR
    Periostin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50450-CF
    Periostin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50450-NF
    Periostin cDNA ORF Clone, Mouse, C-His tag MG50450-CH
    Periostin cDNA ORF Clone, Mouse, N-His tag MG50450-NH
    Periostin cDNA ORF Clone, Mouse, C-HA tag MG50450-CY
    Periostin cDNA ORF Clone, Mouse, N-HA tag MG50450-NY
    Periostin cDNA ORF Clone, Mouse, C-Myc tag MG50450-CM
    Periostin cDNA ORF Clone, Mouse, N-Myc tag MG50450-NM
    Periostin qPCR Primer Pairs, Mouse MP200090

    Periostin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Periostin cDNA ORF Clone in Cloning Vector, Human HG10299-G
    Periostin cDNA ORF Clone, Human, untagged HG10299-UT
    Periostin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10299-ACGLN
    Periostin cDNA ORF Clone, Human, C-GFPSpark® tag HG10299-ACG
    Periostin cDNA ORF Clone, Human, C-OFPSpark® tag HG10299-ACR
    Periostin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10299-CF
    Periostin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10299-NF
    Periostin cDNA ORF Clone, Human, C-His tag HG10299-CH
    Periostin cDNA ORF Clone, Human, N-His tag HG10299-NH
    Periostin cDNA ORF Clone, Human, C-HA tag HG10299-CY
    Periostin cDNA ORF Clone, Human, N-HA tag HG10299-NY
    Periostin cDNA ORF Clone, Human, C-Myc tag HG10299-CM
    Periostin qPCR Primer Pairs, Human HP100342
    info info
    添加购物车成功! 添加购物车失败!