OSER1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16432-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OSER1 Reagents
CRO Services
Product recommended

All OSER1 Reagents
OSER1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Human oxidative stress responsive serine-rich 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OSER1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C20orf111 cDNA ORF Clone, Human;dJ1183I21.1 cDNA ORF Clone, Human;HSPC207 cDNA ORF Clone, Human;Osr1 cDNA ORF Clone, Human;Perit1 cDNA ORF Clone, Human
OSER1 Background Information
Full Name
oxidative stress responsive serine-rich 1

OSER1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OSER1 cDNA ORF Clone in Cloning Vector, Mouse MG52647-U
OSER1 cDNA ORF Clone, Mouse, untagged MG52647-UT
OSER1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52647-ACG
OSER1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52647-ACGLN
OSER1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52647-ANG
OSER1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52647-ACR
OSER1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52647-ANR
OSER1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52647-CF
OSER1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52647-NF
OSER1 cDNA ORF Clone, Mouse, C-His tag MG52647-CH
OSER1 cDNA ORF Clone, Mouse, N-His tag MG52647-NH
OSER1 cDNA ORF Clone, Mouse, C-HA tag MG52647-CY
OSER1 cDNA ORF Clone, Mouse, N-HA tag MG52647-NY
OSER1 cDNA ORF Clone, Mouse, C-Myc tag MG52647-CM
OSER1 cDNA ORF Clone, Mouse, N-Myc tag MG52647-NM
OSER1 qPCR Primer Pairs, Mouse MP202518

OSER1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OSER1 cDNA ORF Clone in Cloning Vector, Human HG16432-G
OSER1 cDNA ORF Clone, Human, untagged HG16432-UT
OSER1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16432-ACGLN
OSER1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16432-ACG
OSER1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16432-ANG
OSER1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16432-ACR
OSER1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16432-ANR
OSER1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16432-NF
OSER1 cDNA ORF Clone, Human, C-His tag HG16432-CH
OSER1 cDNA ORF Clone, Human, N-His tag HG16432-NH
OSER1 cDNA ORF Clone, Human, C-HA tag HG16432-CY
OSER1 cDNA ORF Clone, Human, N-HA tag HG16432-NY
OSER1 cDNA ORF Clone, Human, C-Myc tag HG16432-CM
OSER1 cDNA ORF Clone, Human, N-Myc tag HG16432-NM
OSER1 qPCR Primer Pairs, Human HP105181
info info
添加购物车成功! 添加购物车失败!