Optineurin cDNA ORF Clone, Human, untagged

Cat: HG14478-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Optineurin Reagents
CRO Services
Product recommended

All Optineurin Reagents
Optineurin cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1734 bp
Description
Full length Clone DNA of Human optineurin.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Optineurin cDNA ORF Clone, Human, untagged Alternative Names
ALS12 cDNA ORF Clone, Human;FIP2 cDNA ORF Clone, Human;GLC1E cDNA ORF Clone, Human;HIP7 cDNA ORF Clone, Human;HYPL cDNA ORF Clone, Human;NRP cDNA ORF Clone, Human;TFIIIA-INTP cDNA ORF Clone, Human
Optineurin Background Information

Optineurin gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein.

Full Name
optineurin
References
  • Rezaie T. et al., 2002, Science. 295 (5557): 1077-9.
  • Li Y. et al., 1998, Mol Cell Biol. 18 (3): 1601-10.
  • Skarnes Wc RB. et al., 2011, Nature. 474 (7351): 337-42.
  • Optineurin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Optineurin cDNA ORF Clone in Cloning Vector, Mouse MG53387-U
    Optineurin cDNA ORF Clone, Mouse, untagged MG53387-UT
    Optineurin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53387-ACG
    Optineurin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53387-ACGLN
    Optineurin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53387-ANG
    Optineurin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53387-ACR
    Optineurin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53387-ANR
    Optineurin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53387-CF
    Optineurin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53387-NF
    Optineurin cDNA ORF Clone, Mouse, C-His tag MG53387-CH
    Optineurin cDNA ORF Clone, Mouse, N-His tag MG53387-NH
    Optineurin cDNA ORF Clone, Mouse, C-HA tag MG53387-CY
    Optineurin cDNA ORF Clone, Mouse, N-HA tag MG53387-NY
    Optineurin cDNA ORF Clone, Mouse, C-Myc tag MG53387-CM
    Optineurin cDNA ORF Clone, Mouse, N-Myc tag MG53387-NM

    Optineurin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Optineurin cDNA ORF Clone in Cloning Vector, Human HG14478-G
    Optineurin cDNA ORF Clone, Human, C-GFPSpark® tag HG14478-ACG
    Optineurin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14478-ACGLN
    Optineurin cDNA ORF Clone, Human, N-GFPSpark® tag HG14478-ANG
    Optineurin cDNA ORF Clone, Human, C-OFPSpark® tag HG14478-ACR
    Optineurin cDNA ORF Clone, Human, N-OFPSpark® tag HG14478-ANR
    Optineurin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14478-CF
    Optineurin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14478-NF
    Optineurin cDNA ORF Clone, Human, C-His tag HG14478-CH
    Optineurin cDNA ORF Clone, Human, N-His tag HG14478-NH
    Optineurin cDNA ORF Clone, Human, C-HA tag HG14478-CY
    Optineurin cDNA ORF Clone, Human, N-HA tag HG14478-NY
    Optineurin cDNA ORF Clone, Human, C-Myc tag HG14478-CM
    Optineurin cDNA ORF Clone, Human, N-Myc tag HG14478-NM
    Optineurin qPCR Primer Pairs, Human HP103126
    info info
    添加购物车成功! 添加购物车失败!