Olfactory Marker Protein cDNA ORF Clone, Human, untagged

Cat: HG15345-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Olfactory Marker Protein Reagents
CRO Services
Product recommended

All Olfactory Marker Protein Reagents
Olfactory Marker Protein cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
492 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human olfactory marker protein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+0.49kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Olfactory Marker Protein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Olfactory Marker Protein cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Olfactory Marker Protein cDNA ORF Clone, Human, untagged Alternative Names
OMP cDNA ORF Clone, Human
Olfactory Marker Protein Background Information
Full Name
olfactory marker protein

Olfactory Marker Protein cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Olfactory Marker Protein cDNA ORF Clone in Cloning Vector, Mouse MG57376-U
Olfactory Marker Protein cDNA ORF Clone, Mouse, untagged MG57376-UT
Olfactory Marker Protein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57376-ACG
Olfactory Marker Protein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57376-ACGLN
Olfactory Marker Protein cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57376-ANG
Olfactory Marker Protein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57376-ACR
Olfactory Marker Protein cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57376-ANR
Olfactory Marker Protein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57376-CF
Olfactory Marker Protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57376-NF
Olfactory Marker Protein cDNA ORF Clone, Mouse, C-His tag MG57376-CH
Olfactory Marker Protein cDNA ORF Clone, Mouse, N-His tag MG57376-NH
Olfactory Marker Protein cDNA ORF Clone, Mouse, C-HA tag MG57376-CY
Olfactory Marker Protein cDNA ORF Clone, Mouse, N-HA tag MG57376-NY
Olfactory Marker Protein cDNA ORF Clone, Mouse, C-Myc tag MG57376-CM
Olfactory Marker Protein cDNA ORF Clone, Mouse, N-Myc tag MG57376-NM

Olfactory Marker Protein cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Olfactory Marker Protein cDNA ORF Clone in Cloning Vector, Human HG15345-G
Olfactory Marker Protein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15345-ACGLN
Olfactory Marker Protein cDNA ORF Clone, Human, C-GFPSpark® tag HG15345-ACG
Olfactory Marker Protein cDNA ORF Clone, Human, N-GFPSpark® tag HG15345-ANG
Olfactory Marker Protein cDNA ORF Clone, Human, C-OFPSpark® tag HG15345-ACR
Olfactory Marker Protein cDNA ORF Clone, Human, N-OFPSpark® tag HG15345-ANR
Olfactory Marker Protein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15345-CF
Olfactory Marker Protein cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15345-NF
Olfactory Marker Protein cDNA ORF Clone, Human, C-His tag HG15345-CH
Olfactory Marker Protein cDNA ORF Clone, Human, N-His tag HG15345-NH
Olfactory Marker Protein cDNA ORF Clone, Human, C-HA tag HG15345-CY
Olfactory Marker Protein cDNA ORF Clone, Human, N-HA tag HG15345-NY
Olfactory Marker Protein cDNA ORF Clone, Human, C-Myc tag HG15345-CM
Olfactory Marker Protein cDNA ORF Clone, Human, N-Myc tag HG15345-NM
Olfactory Marker Protein qPCR Primer Pairs, Human HP103969
info info
添加购物车成功! 添加购物车失败!