Quick Order

Text Size:AAA

Human OMP / Olfactory marker protein Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human OMP cDNA Clone Product Information
NCBI RefSeq:BC069365
RefSeq ORF Size:492 bp
cDNA Description:Full length Clone DNA of Homo sapiens olfactory marker protein.
Gene Synonym:OMP
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-OMP
Restriction Site:KpnI + XbaI(6.1kb+0.49kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Human OMP / Olfactory marker protein Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG15345-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"