Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, N-His tag

Cat: HG10269-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Oligodendrocyte myelin glycoprotein Reagents
CRO Services
Product recommended

All Oligodendrocyte myelin glycoprotein Reagents
Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1323 bp
Description
Full length Clone DNA of Human oligodendrocyte myelin glycoprotein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, N-His tag Alternative Names
OMGP cDNA ORF Clone, Human
Oligodendrocyte myelin glycoprotein Background Information

Oligodendrocyte-myelin glycoprotein, also known as OMG and OMGP, is a cell membrane protein which contains eight LRR (leucine-rich) repeats. OMG / OMGP is a glycosylphosphatidylinositol-anchored protein expressed by neurons and oligodendrocytes in the central nervous system (CNS). OMG / OMGP is a cell adhesion molecule contributing to the interactive process required for myelination in the central nervous system. OMG / OMGP play roles in both the developing and adult central nervous system. OMG / OMGP participats in growth cone collapse and inhibition of neurite outgrowth through its interaction with NgR, the receptor for Nogo. This function requires its leucine-rich repeat domain, a highly conserved region in OMgp during mammal evolution. OMG / OMGP leucine-rich repeat domain is also implicated in the inhibition of cell proliferation. OMG / OMGP may also be involved in the formation and maintenance of myelin sheaths. Cell proliferation, neuronal sprouting and myelination are crucial processes involved in brain development and regeneration after injury.

Full Name
oligodendrocyte myelin glycoprotein
References
  • Viskochil D., et al.,(1991), The gene encoding the oligodendrocyte-myelin glycoprotein is embedded within the neurofibromatosis type 1 gene. Mol. Cell. Biol. 11:906-912.
  • Mikol D.D., et al., (1990), The oligodendrocyte-myelin glycoprotein belongs to a distinct family of proteins and contains the HNK-1 carbohydrate.J. Cell Biol. 110:471-479.
  • Mikol D.D., et al.,(1990), Structure and chromosomal localization of the gene for the oligodendrocyte-myelin glycoprotein.J. Cell Biol. 111:2673-2679.
  • Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone in Cloning Vector, Rhesus CG90713-G
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, untagged CG90713-UT
    Oligodendrocyte myelin glycoprotein Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90713-ACGLN
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90713-ACG
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90713-ACR
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90713-CF
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90713-NF
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, C-His tag CG90713-CH
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, N-His tag CG90713-NH
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, C-HA tag CG90713-CY
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, N-HA tag CG90713-NY
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, C-Myc tag CG90713-CM
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rhesus, N-Myc tag CG90713-NM

    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone in Cloning Vector, Rabbit TG65088-G
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, untagged TG65088-UT
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65088-ACG
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65088-ACR
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65088-CF
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65088-NF
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, C-His tag TG65088-CH
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, N-His tag TG65088-NH
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, C-HA tag TG65088-CY
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, N-HA tag TG65088-NY
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, C-Myc tag TG65088-CM
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Rabbit, N-Myc tag TG65088-NM

    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone in Cloning Vector, Human HG10269-M
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, untagged HG10269-UT
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, C-GFPSpark® tag HG10269-ACG
    Oligodendrocyte myelin glycoprotein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10269-ACGLN
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, C-OFPSpark® tag HG10269-ACR
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10269-CF
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10269-NF
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, C-His tag HG10269-CH
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, C-HA tag HG10269-CY
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, N-HA tag HG10269-NY
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, C-Myc tag HG10269-CM
    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Human, N-Myc tag HG10269-NM
    Oligodendrocyte myelin glycoprotein qPCR Primer Pairs, Human HP100317

    Oligodendrocyte myelin glycoprotein cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Oligodendrocyte myelin glycoprotein qPCR Primer Pairs, Mouse MP200664
    info info
    添加购物车成功! 添加购物车失败!