Quick Order

Human Osteomodulin Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human OMD cDNA Clone Product Information
NCBI RefSeq:NM_005014.2
RefSeq ORF Size:1266bp
cDNA Description:Full length Clone DNA of Homo sapiens osteomodulin with N terminal Myc tag.
Gene Synonym:OSAD, SLRR2C, OMD
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Osteomodulin (OMD), also known as Osteoadherin (OSAD), Keratan sulfate proteoglycan osteomodulin, KSPG osteomodulin, and SLRR2C, is a secreted protein which belongs to the small leucine-rich proteoglycan (SLRP) family and Class II subfamily. SLRP family proteins are normally found in extracellular matrices, but Osteomodulin is the only member restricted to mineralized tissues. Osteomodulin is primarily expressed by osteoblasts and might have a role in regulation of mineralization. In bone OSAD has been localized in primary spongiosa within the bovine fetal rib growth plate. Moreover, in situ hybridization has shown expression of OSAD in osteoblasts close to the cartilage and bone border in the growth plate of rat femur. OSAD may play an important role during tooth development and biomineralization of dentin. Osteomodulin is a cell binding keratan sulfate proteoglycan which was recently isolated from mineralized bovine bone and subsequently cloned and sequenced. Osteomodulin may be implicated in biomineralization processes. It has a function in binding of osteoblasts via the alpha (V) beta (3)-integrin. It is likely that Osteomodulin is an osteoblast maturation marker that is induced by osteoclast activity. Osteomodulin is also an early marker for terminally differentiated matrix producing osteoblasts.

References
  • Buchaille R, et al. (2000) Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone. 27(2): 265-70.
  • Petersson U, et al. (2003) Identification, distribution and expression of osteoadherin during tooth formation. Eur J Oral Sci. 111(2): 128-36.
  • Rehn AP, et al. (2006) Differential regulation of osteoadherin (OSAD) by TGF-beta1 and BMP-2. Biochem Biophys Res Commun. 349(3): 1057-64.
  • Size / Price
    Catalog: HG10825-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"