Noelin-1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10851-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Noelin-1 Reagents
CRO Services
Product recommended

All Noelin-1 Reagents
Noelin-1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Human olfactomedin 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Noelin-1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
AMY cDNA ORF Clone, Human;NOE1 cDNA ORF Clone, Human;NOELIN1 cDNA ORF Clone, Human;OlfA cDNA ORF Clone, Human
Noelin-1 Background Information
Full Name
olfactomedin 1

Noelin-1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Noelin-1 cDNA ORF Clone in Cloning Vector, Mouse MG51856-G
Noelin-1 cDNA ORF Clone, Mouse, untagged MG51856-UT
Noelin-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51856-ACGLN
Noelin-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51856-ACG
Noelin-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51856-ACR
Noelin-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51856-CF
Noelin-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51856-NF
Noelin-1 cDNA ORF Clone, Mouse, C-His tag MG51856-CH
Noelin-1 cDNA ORF Clone, Mouse, N-His tag MG51856-NH
Noelin-1 cDNA ORF Clone, Mouse, C-HA tag MG51856-CY
Noelin-1 cDNA ORF Clone, Mouse, N-HA tag MG51856-NY
Noelin-1 cDNA ORF Clone, Mouse, C-Myc tag MG51856-CM
Noelin-1 cDNA ORF Clone, Mouse, N-Myc tag MG51856-NM
Noelin-1 qPCR Primer Pairs, Mouse MP201729

Noelin-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Noelin-1 cDNA ORF Clone in Cloning Vector, Human HG10851-M
Noelin-1 cDNA ORF Clone in Cloning Vector, Human HG11281-M
Noelin-1 cDNA ORF Clone, Human, untagged HG10851-UT
Noelin-1 cDNA ORF Clone, Human, untagged HG11281-UT
Noelin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10851-ACG
Noelin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10851-ACGLN
Noelin-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11281-ACG
Noelin-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11281-ACGLN
Noelin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11281-ACR
Noelin-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10851-ACR
Noelin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10851-CF
Noelin-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11281-CF
Noelin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10851-NF
Noelin-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11281-NF
Noelin-1 cDNA ORF Clone, Human, C-His tag HG10851-CH
Noelin-1 cDNA ORF Clone, Human, C-His tag HG11281-CH
Noelin-1 cDNA ORF Clone, Human, N-His tag HG11281-NH
Noelin-1 cDNA ORF Clone, Human, N-His tag HG10851-NH
Noelin-1 cDNA ORF Clone, Human, C-HA tag HG11281-CY
Noelin-1 cDNA ORF Clone, Human, C-HA tag HG10851-CY
Noelin-1 cDNA ORF Clone, Human, N-HA tag HG11281-NY
Noelin-1 cDNA ORF Clone, Human, N-HA tag HG10851-NY
Noelin-1 cDNA ORF Clone, Human, C-Myc tag HG11281-CM
Noelin-1 cDNA ORF Clone, Human, C-Myc tag HG10851-CM
Noelin-1 cDNA ORF Clone, Human, N-Myc tag HG11281-NM
Noelin-1 qPCR Primer Pairs, Human HP100748
info info
添加购物车成功! 添加购物车失败!