OCIAD1 cDNA ORF Clone, Human, C-His tag

Cat: HG14645-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OCIAD1 Reagents
CRO Services
Product recommended

All OCIAD1 Reagents
OCIAD1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Human OCIA domain containing 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OCIAD1 cDNA ORF Clone, Human, C-His tag Alternative Names
ASRIJ cDNA ORF Clone, Human;OCIA cDNA ORF Clone, Human;TPA018 cDNA ORF Clone, Human
OCIAD1 Background Information
Full Name
OCIA domain containing 1

OCIAD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OCIAD1 cDNA ORF Clone in Cloning Vector, Mouse MG51945-G
OCIAD1 cDNA ORF Clone, Mouse, untagged MG51945-UT
OCIAD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51945-ACG
OCIAD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51945-ACGLN
OCIAD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51945-ANG
OCIAD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51945-ACR
OCIAD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51945-ANR
OCIAD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51945-CF
OCIAD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51945-NF
OCIAD1 cDNA ORF Clone, Mouse, C-His tag MG51945-CH
OCIAD1 cDNA ORF Clone, Mouse, N-His tag MG51945-NH
OCIAD1 cDNA ORF Clone, Mouse, C-HA tag MG51945-CY
OCIAD1 cDNA ORF Clone, Mouse, N-HA tag MG51945-NY
OCIAD1 cDNA ORF Clone, Mouse, C-Myc tag MG51945-CM
OCIAD1 cDNA ORF Clone, Mouse, N-Myc tag MG51945-NM
OCIAD1 qPCR Primer Pairs, Mouse MP201818

OCIAD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OCIAD1 cDNA ORF Clone in Cloning Vector, Human HG14645-G
OCIAD1 cDNA ORF Clone, Human, untagged HG14645-UT
OCIAD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14645-ACG
OCIAD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14645-ACGLN
OCIAD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14645-ANG
OCIAD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14645-ACR
OCIAD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14645-ANR
OCIAD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14645-CF
OCIAD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14645-NF
OCIAD1 cDNA ORF Clone, Human, N-His tag HG14645-NH
OCIAD1 cDNA ORF Clone, Human, C-HA tag HG14645-CY
OCIAD1 cDNA ORF Clone, Human, N-HA tag HG14645-NY
OCIAD1 cDNA ORF Clone, Human, C-Myc tag HG14645-CM
OCIAD1 cDNA ORF Clone, Human, N-Myc tag HG14645-NM
OCIAD1 qPCR Primer Pairs, Human HP103279
info info
添加购物车成功! 添加购物车失败!