OPCML cDNA ORF Clone, Human, N-Myc tag

Cat: HG10328-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OPCML Reagents
CRO Services
Product recommended

All OPCML Reagents
OPCML cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Human opioid binding protein/cell adhesion molecule-like transcript variant 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OPCML cDNA ORF Clone, Human, N-Myc tag Alternative Names
IGLON1 cDNA ORF Clone, Human;OBCAM cDNA ORF Clone, Human;OPCM cDNA ORF Clone, Human
OPCML Background Information

Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

Full Name
opioid binding protein/cell adhesion molecule-like
References
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • OPCML cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    OPCML cDNA ORF Clone in Cloning Vector, Rat RG80397-G
    OPCML cDNA ORF Clone, Rat, untagged RG80397-UT
    OPCML Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80397-ACGLN
    OPCML cDNA ORF Clone, Rat, C-GFPSpark® tag RG80397-ACG
    OPCML cDNA ORF Clone, Rat, C-OFPSpark® tag RG80397-ACR
    OPCML cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80397-CF
    OPCML cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80397-NF
    OPCML cDNA ORF Clone, Rat, C-His tag RG80397-CH
    OPCML cDNA ORF Clone, Rat, N-His tag RG80397-NH
    OPCML cDNA ORF Clone, Rat, C-HA tag RG80397-CY
    OPCML cDNA ORF Clone, Rat, N-HA tag RG80397-NY
    OPCML cDNA ORF Clone, Rat, C-Myc tag RG80397-CM
    OPCML cDNA ORF Clone, Rat, N-Myc tag RG80397-NM
    OPCML qPCR Primer Pairs, Rat RP300363

    OPCML cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    OPCML cDNA ORF Clone in Cloning Vector, Mouse MG51073-G
    OPCML cDNA ORF Clone, Mouse, untagged MG51073-UT
    OPCML cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51073-ACG
    OPCML Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51073-ACGLN
    OPCML cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51073-ACR
    OPCML cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51073-CF
    OPCML cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51073-NF
    OPCML cDNA ORF Clone, Mouse, C-His tag MG51073-CH
    OPCML cDNA ORF Clone, Mouse, N-His tag MG51073-NH
    OPCML cDNA ORF Clone, Mouse, C-HA tag MG51073-CY
    OPCML cDNA ORF Clone, Mouse, N-HA tag MG51073-NY
    OPCML cDNA ORF Clone, Mouse, C-Myc tag MG51073-CM
    OPCML cDNA ORF Clone, Mouse, N-Myc tag MG51073-NM
    OPCML qPCR Primer Pairs, Mouse MP201031

    OPCML cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    OPCML cDNA ORF Clone in Cloning Vector, Human HG10328-M
    OPCML cDNA ORF Clone, Human, untagged HG10328-UT
    OPCML Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10328-ACGLN
    OPCML cDNA ORF Clone, Human, C-GFPSpark® tag HG10328-ACG
    OPCML cDNA ORF Clone, Human, C-OFPSpark® tag HG10328-ACR
    OPCML cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10328-CF
    OPCML cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10328-NF
    OPCML cDNA ORF Clone, Human, C-His tag HG10328-CH
    OPCML cDNA ORF Clone, Human, N-His tag HG10328-NH
    OPCML cDNA ORF Clone, Human, C-HA tag HG10328-CY
    OPCML cDNA ORF Clone, Human, N-HA tag HG10328-NY
    OPCML cDNA ORF Clone, Human, C-Myc tag HG10328-CM
    OPCML qPCR Primer Pairs, Human HP100368
    info info
    添加购物车成功! 添加购物车失败!