OAF cDNA ORF Clone, Human, N-Myc tag

Cat: HG13761-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OAF Reagents
CRO Services
Product recommended

All OAF Reagents
OAF cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
822 bp
Description
Full length Clone DNA of Human OAF homolog (Drosophila) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OAF cDNA ORF Clone, Human, N-Myc tag Alternative Names
NS5ATP13TP2 cDNA ORF Clone, Human
OAF Background Information
Full Name
OAF homolog (Drosophila)

OAF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OAF cDNA ORF Clone in Cloning Vector, Mouse MG5A5450-U
OAF cDNA ORF Clone, Mouse, untagged MG5A5450-UT
OAF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5450-ACGLN
OAF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5450-ACG
OAF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5450-ACR
OAF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5450-CF
OAF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5450-NF
OAF cDNA ORF Clone, Mouse, C-His tag MG5A5450-CH
OAF cDNA ORF Clone, Mouse, N-His tag MG5A5450-NH
OAF cDNA ORF Clone, Mouse, C-HA tag MG5A5450-CY
OAF cDNA ORF Clone, Mouse, N-HA tag MG5A5450-NY
OAF cDNA ORF Clone, Mouse, C-Myc tag MG5A5450-CM
OAF cDNA ORF Clone, Mouse, N-Myc tag MG5A5450-NM

OAF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OAF cDNA ORF Clone in Cloning Vector, Human HG13761-G
OAF cDNA ORF Clone, Human, untagged HG13761-UT
OAF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13761-ACGLN
OAF cDNA ORF Clone, Human, C-GFPSpark® tag HG13761-ACG
OAF cDNA ORF Clone, Human, C-OFPSpark® tag HG13761-ACR
OAF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13761-CF
OAF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13761-NF
OAF cDNA ORF Clone, Human, C-His tag HG13761-CH
OAF cDNA ORF Clone, Human, N-His tag HG13761-NH
OAF cDNA ORF Clone, Human, C-HA tag HG13761-CY
OAF cDNA ORF Clone, Human, N-HA tag HG13761-NY
OAF cDNA ORF Clone, Human, C-Myc tag HG13761-CM
OAF qPCR Primer Pairs, Human HP102437
info info
添加购物车成功! 添加购物车失败!