NXPH1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10855-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NXPH1 Reagents
CRO Services
Product recommended

All NXPH1 Reagents
NXPH1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Human neurexophilin 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NXPH1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
Nbla00697 cDNA ORF Clone, Human;NPH1 cDNA ORF Clone, Human
NXPH1 Background Information

Neurexophilin-1, or NXPH1 is a secreted glycoprotein, which belongs to the Neurexophilin family. The Neurexophilin family contain at least four genes and resembles a neuropeptide, suggesting a function as an endogenous ligand for alpha-neurexins. The mammalian brains contain four genes for neurexophilins the products of which share a common structure composed of five domains: an N-terminal signal peptide, a variable N-terminal domain, a highly conserved central domain that is N-glycosylated, a short linker region, and a conserved C-terminal domain that is cysteine-rich. Neurexophilin-1 constitutes a secreted cysteine-rich glycoprotein, forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. Neurexophilins 1 and 3 but not 4 (neurexophilin 2 is not expressed in rodents) bind to a single individual LNS domain, the second overall LNS domain in all three alpha-neurexins.

Full Name
neurexophilin 1
References
  • Missler M, et al. (1998) Neurexophilin binding to alpha-neurexins. A single LNS domain functions as an independently folding ligand-binding unit. J Biol Chem. 273(52): 34716-23.
  • Missler M, et al. (1998) Neurexophilins form a conserved family of neuropeptide-like glycoproteins. J Neurosci. 18(10): 3630-8.
  • Petrenko AG, et al. (1996) Structure and evolution of neurexophilin. J Neurosci. 16(14): 4360-9.
  • NXPH1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    NXPH1 cDNA ORF Clone in Cloning Vector, Rat RG80047-M
    NXPH1 cDNA ORF Clone, Rat, untagged RG80047-UT
    NXPH1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80047-ACGLN
    NXPH1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80047-ACG
    NXPH1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80047-ACR
    NXPH1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80047-CF
    NXPH1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80047-NF
    NXPH1 cDNA ORF Clone, Rat, C-His tag RG80047-CH
    NXPH1 cDNA ORF Clone, Rat, N-His tag RG80047-NH
    NXPH1 cDNA ORF Clone, Rat, C-HA tag RG80047-CY
    NXPH1 cDNA ORF Clone, Rat, N-HA tag RG80047-NY
    NXPH1 cDNA ORF Clone, Rat, C-Myc tag RG80047-CM
    NXPH1 cDNA ORF Clone, Rat, N-Myc tag RG80047-NM
    NXPH1 qPCR Primer Pairs, Rat RP300046

    NXPH1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NXPH1 cDNA ORF Clone in Cloning Vector, Mouse MG50865-G
    NXPH1 cDNA ORF Clone, Mouse, untagged MG50865-UT
    NXPH1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50865-ACG
    NXPH1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50865-ACGLN
    NXPH1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50865-ACR
    NXPH1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50865-CF
    NXPH1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50865-NF
    NXPH1 cDNA ORF Clone, Mouse, C-His tag MG50865-CH
    NXPH1 cDNA ORF Clone, Mouse, N-His tag MG50865-NH
    NXPH1 cDNA ORF Clone, Mouse, C-HA tag MG50865-CY
    NXPH1 cDNA ORF Clone, Mouse, N-HA tag MG50865-NY
    NXPH1 cDNA ORF Clone, Mouse, C-Myc tag MG50865-CM
    NXPH1 cDNA ORF Clone, Mouse, N-Myc tag MG50865-NM
    NXPH1 qPCR Primer Pairs, Mouse MP200836

    NXPH1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NXPH1 cDNA ORF Clone in Cloning Vector, Human HG10855-M
    NXPH1 cDNA ORF Clone, Human, untagged HG10855-UT
    NXPH1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10855-ACG
    NXPH1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10855-ACGLN
    NXPH1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10855-ACR
    NXPH1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10855-CF
    NXPH1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10855-NF
    NXPH1 cDNA ORF Clone, Human, C-His tag HG10855-CH
    NXPH1 cDNA ORF Clone, Human, N-His tag HG10855-NH
    NXPH1 cDNA ORF Clone, Human, C-HA tag HG10855-CY
    NXPH1 cDNA ORF Clone, Human, N-HA tag HG10855-NY
    NXPH1 cDNA ORF Clone, Human, C-Myc tag HG10855-CM
    NXPH1 qPCR Primer Pairs, Human HP100750
    info info
    添加购物车成功! 添加购物车失败!