NPNT/Nephronectin cDNA ORF Clone, Human, N-Myc tag

Cat: HG10932-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NPNT/Nephronectin Reagents
CRO Services
Product recommended

All NPNT/Nephronectin Reagents
NPNT/Nephronectin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1698 bp
Description
Full length Clone DNA of Human nephronectin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NPNT/Nephronectin cDNA ORF Clone, Human, N-Myc tag Alternative Names
EGFL6L cDNA ORF Clone, Human;POEM cDNA ORF Clone, Human
NPNT/Nephronectin Background Information
Full Name
nephronectin

NPNT/Nephronectin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NPNT/Nephronectin cDNA ORF Clone in Cloning Vector, Mouse MG50210-M
NPNT/Nephronectin cDNA ORF Clone, Mouse, untagged MG50210-UT
NPNT/Nephronectin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50210-ACGLN
NPNT/Nephronectin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50210-ACG
NPNT/Nephronectin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50210-ACR
NPNT/Nephronectin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50210-CF
NPNT/Nephronectin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50210-NF
NPNT/Nephronectin cDNA ORF Clone, Mouse, C-His tag MG50210-CH
NPNT/Nephronectin cDNA ORF Clone, Mouse, N-His tag MG50210-NH
NPNT/Nephronectin cDNA ORF Clone, Mouse, C-HA tag MG50210-CY
NPNT/Nephronectin cDNA ORF Clone, Mouse, N-HA tag MG50210-NY
NPNT/Nephronectin cDNA ORF Clone, Mouse, C-Myc tag MG50210-CM
NPNT/Nephronectin cDNA ORF Clone, Mouse, N-Myc tag MG50210-NM
NPNT/Nephronectin qPCR Primer Pairs, Mouse MP200238

NPNT/Nephronectin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NPNT/Nephronectin cDNA ORF Clone in Cloning Vector, Human HG10932-M
NPNT/Nephronectin cDNA ORF Clone, Human, untagged HG10932-UT
NPNT/Nephronectin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10932-ACGLN
NPNT/Nephronectin cDNA ORF Clone, Human, C-GFPSpark® tag HG10932-ACG
NPNT/Nephronectin cDNA ORF Clone, Human, C-OFPSpark® tag HG10932-ACR
NPNT/Nephronectin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10932-CF
NPNT/Nephronectin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10932-NF
NPNT/Nephronectin cDNA ORF Clone, Human, C-His tag HG10932-CH
NPNT/Nephronectin cDNA ORF Clone, Human, N-His tag HG10932-NH
NPNT/Nephronectin cDNA ORF Clone, Human, C-HA tag HG10932-CY
NPNT/Nephronectin cDNA ORF Clone, Human, N-HA tag HG10932-NY
NPNT/Nephronectin cDNA ORF Clone, Human, C-Myc tag HG10932-CM
NPNT/Nephronectin qPCR Primer Pairs, Human HP100933
info info
添加购物车成功! 添加购物车失败!