FAM55C cDNA ORF Clone, Human, N-HA tag

Cat: HG13580-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAM55C Reagents
CRO Services
Product recommended

All FAM55C Reagents
FAM55C cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1680 bp
Description
Full length Clone DNA of Human neurexophilin and PC-esterase domain family, member 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About FAM55C
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM55C cDNA ORF Clone, Human, N-HA tag Alternative Names
FAM55C cDNA ORF Clone, Human;MST115 cDNA ORF Clone, Human;MSTP115 cDNA ORF Clone, Human
FAM55C Background Information
Full Name
neurexophilin and PC-esterase domain family, member 3

FAM55C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM55C cDNA ORF Clone in Cloning Vector, Mouse MG55787-U
FAM55C cDNA ORF Clone, Mouse, untagged MG55787-UT
FAM55C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55787-ACG
FAM55C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55787-ACGLN
FAM55C cDNA ORF Clone, Mouse, N-GFPSpark® tag MG55787-ANG
FAM55C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55787-ACR
FAM55C cDNA ORF Clone, Mouse, N-OFPSpark® tag MG55787-ANR
FAM55C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55787-CF
FAM55C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55787-NF
FAM55C cDNA ORF Clone, Mouse, C-His tag MG55787-CH
FAM55C cDNA ORF Clone, Mouse, N-His tag MG55787-NH
FAM55C cDNA ORF Clone, Mouse, C-HA tag MG55787-CY
FAM55C cDNA ORF Clone, Mouse, N-HA tag MG55787-NY
FAM55C cDNA ORF Clone, Mouse, C-Myc tag MG55787-CM
FAM55C cDNA ORF Clone, Mouse, N-Myc tag MG55787-NM

FAM55C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM55C cDNA ORF Clone in Cloning Vector, Human HG27958-U
FAM55C cDNA ORF Clone in Cloning Vector, Human HG13580-G
FAM55C cDNA ORF Clone, Human, untagged HG13580-UT
FAM55C cDNA ORF Clone, Human, untagged HG27958-UT
FAM55C cDNA ORF Clone, Human, C-GFPSpark® tag HG27958-ACG
FAM55C cDNA ORF Clone, Human, C-GFPSpark® tag HG13580-ACG
FAM55C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13580-ACGLN
FAM55C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27958-ACGLN
FAM55C cDNA ORF Clone, Human, N-GFPSpark® tag HG27958-ANG
FAM55C cDNA ORF Clone, Human, C-OFPSpark® tag HG27958-ACR
FAM55C cDNA ORF Clone, Human, C-OFPSpark® tag HG13580-ACR
FAM55C cDNA ORF Clone, Human, N-OFPSpark® tag HG27958-ANR
FAM55C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG27958-CF
FAM55C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13580-CF
FAM55C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG27958-NF
FAM55C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13580-NF
FAM55C cDNA ORF Clone, Human, C-His tag HG13580-CH
FAM55C cDNA ORF Clone, Human, C-His tag HG27958-CH
FAM55C cDNA ORF Clone, Human, N-His tag HG27958-NH
FAM55C cDNA ORF Clone, Human, N-His tag HG13580-NH
FAM55C cDNA ORF Clone, Human, C-HA tag HG13580-CY
FAM55C cDNA ORF Clone, Human, C-HA tag HG27958-CY
FAM55C cDNA ORF Clone, Human, N-HA tag HG27958-NY
FAM55C cDNA ORF Clone, Human, C-Myc tag HG13580-CM
FAM55C cDNA ORF Clone, Human, C-Myc tag HG27958-CM
FAM55C cDNA ORF Clone, Human, N-Myc tag HG13580-NM
FAM55C cDNA ORF Clone, Human, N-Myc tag HG27958-NM
FAM55C qPCR Primer Pairs, Human HP102266
info info
添加购物车成功! 添加购物车失败!