NXF1 cDNA ORF Clone, Human, C-HA tag

Cat: HG16438-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NXF1 Reagents
CRO Services
Product recommended

All NXF1 Reagents
NXF1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1860 bp
Description
Full length Clone DNA of Human nuclear RNA export factor 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NXF1 cDNA ORF Clone, Human, C-HA tag Alternative Names
MEX67 cDNA ORF Clone, Human;TAP cDNA ORF Clone, Human
NXF1 Background Information
Full Name
nuclear RNA export factor 1

NXF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NXF1 cDNA ORF Clone in Cloning Vector, Mouse MG53733-U
NXF1 cDNA ORF Clone, Mouse, untagged MG53733-UT
NXF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53733-ACGLN
NXF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53733-ACG
NXF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53733-ANG
NXF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53733-ACR
NXF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53733-ANR
NXF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53733-CF
NXF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53733-NF
NXF1 cDNA ORF Clone, Mouse, C-His tag MG53733-CH
NXF1 cDNA ORF Clone, Mouse, N-His tag MG53733-NH
NXF1 cDNA ORF Clone, Mouse, C-HA tag MG53733-CY
NXF1 cDNA ORF Clone, Mouse, N-HA tag MG53733-NY
NXF1 cDNA ORF Clone, Mouse, C-Myc tag MG53733-CM
NXF1 cDNA ORF Clone, Mouse, N-Myc tag MG53733-NM

NXF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NXF1 cDNA ORF Clone in Cloning Vector, Human HG16438-G
NXF1 cDNA ORF Clone, Human, untagged HG16438-UT
NXF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16438-ACG
NXF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16438-ACGLN
NXF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16438-ANG
NXF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16438-ACR
NXF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16438-ANR
NXF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16438-CF
NXF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16438-NF
NXF1 cDNA ORF Clone, Human, C-His tag HG16438-CH
NXF1 cDNA ORF Clone, Human, N-His tag HG16438-NH
NXF1 cDNA ORF Clone, Human, N-HA tag HG16438-NY
NXF1 cDNA ORF Clone, Human, C-Myc tag HG16438-CM
NXF1 cDNA ORF Clone, Human, N-Myc tag HG16438-NM
NXF1 qPCR Primer Pairs, Human HP105186
info info
添加购物车成功! 添加购物车失败!