Quick Order

Human METTL11A Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human NTMT1 cDNA Clone Product Information
    NCBI RefSeq:NM_014064.2
    RefSeq ORF Size:672bp
    cDNA Description:Full length Clone DNA of Homo sapiens N-terminal Xaa-Pro-Lys N-methyltransferase 1.
    Gene Synonym:AD-003, C9orf32, METTL11A
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NTMT1 qPCR primers for gene expression analysis, HP101123 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    Methyltransferase-like protein 11A, also known as METTL11A, is a member of the methyltransferase superfamily and METTL11 family. Methyltransferase is a type of transferase enzyme which transfers a methyl group from a donor to an acceptor. Methylation often occurs on nucleic bases in DNA or amino acids in protein structures. Methytransferase uses a reactive methyl group bound to sulfur in S-adenosyl methionine (SAM) as the methyl donor. DNA methylation is often utilized to silence and regulate genes without changing the original DNA sequence. This methylation occurs on cytosine residues. DNA methylation may be necessary for normal growth from embryonic stages in mammals. Methylation can serve to protect DNA from enzymatic cleavage, since restriction enzymes are unable to bind and recognize externally modified sequences. This is especially useful in bacterial restriction modification systems which use restriction enzymes to cleave foreign DNA while keeping their own DNA protected by methylation. Methylation of amino acids in the formation of proteins leads to more diversity of possible amino acids and therefore more diversity of function. The methylation reaction occurs on nitrogen atoms either on the N terminus or side-chain position of the protein and are usually irreversible.

    Size / Price
    Catalog: HG11222-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"