HNT cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15169-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HNT Reagents
CRO Services
Product recommended

All HNT Reagents
HNT cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Human neurotrimin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNT cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HNT cDNA ORF Clone, Human;IGLON2 cDNA ORF Clone, Human;NTRI cDNA ORF Clone, Human
HNT Background Information
Full Name
neurotrimin

HNT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HNT cDNA ORF Clone in Cloning Vector, Mouse MG51394-U
HNT cDNA ORF Clone, Mouse, untagged MG51394-UT
HNT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51394-ACGLN
HNT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51394-ACG
HNT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51394-ANG
HNT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51394-ACR
HNT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51394-ANR
HNT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51394-CF
HNT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51394-NF
HNT cDNA ORF Clone, Mouse, C-His tag MG51394-CH
HNT cDNA ORF Clone, Mouse, N-His tag MG51394-NH
HNT cDNA ORF Clone, Mouse, C-HA tag MG51394-CY
HNT cDNA ORF Clone, Mouse, N-HA tag MG51394-NY
HNT cDNA ORF Clone, Mouse, C-Myc tag MG51394-CM
HNT cDNA ORF Clone, Mouse, N-Myc tag MG51394-NM
HNT qPCR Primer Pairs, Mouse MP201264

HNT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNT cDNA ORF Clone in Cloning Vector, Human HG15169-G
HNT cDNA ORF Clone, Human, untagged HG15169-UT
HNT cDNA ORF Clone, Human, C-GFPSpark® tag HG15169-ACG
HNT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15169-ACGLN
HNT cDNA ORF Clone, Human, C-OFPSpark® tag HG15169-ACR
HNT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15169-NF
HNT cDNA ORF Clone, Human, C-His tag HG15169-CH
HNT cDNA ORF Clone, Human, N-His tag HG15169-NH
HNT cDNA ORF Clone, Human, C-HA tag HG15169-CY
HNT cDNA ORF Clone, Human, N-HA tag HG15169-NY
HNT cDNA ORF Clone, Human, C-Myc tag HG15169-CM
HNT cDNA ORF Clone, Human, N-Myc tag HG15169-NM
HNT qPCR Primer Pairs, Human HP103796
info info
添加购物车成功! 添加购物车失败!