Neurotrophin 3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10286-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Neurotrophin 3 Reagents
CRO Services
Product recommended

All Neurotrophin 3 Reagents
Neurotrophin 3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
774 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 291G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human neurotrophin 3, transcript variant 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
KpnI + XbaI (6kb + 0.81kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Neurotrophin 3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neurotrophin 3 cDNA ORF Clone, Human, N-Myc tag Validated Images
Ferret CD3e/CD3 epsilon Gene Plasmid Map 5630
Neurotrophin 3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
HDNF cDNA ORF Clone, Human;NGF-2 cDNA ORF Clone, Human;NGF2 cDNA ORF Clone, Human;NT-3 cDNA ORF Clone, Human;NT3 cDNA ORF Clone, Human
Neurotrophin 3 Background Information
Full Name
neurotrophin 3

Neurotrophin 3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Neurotrophin 3 cDNA ORF Clone in Cloning Vector, Mouse MG50223-M
Neurotrophin 3 cDNA ORF Clone, Mouse, untagged MG50223-UT
Neurotrophin 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50223-ACGLN
Neurotrophin 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50223-ACG
Neurotrophin 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50223-ACR
Neurotrophin 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50223-CF
Neurotrophin 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50223-NF
Neurotrophin 3 cDNA ORF Clone, Mouse, C-His tag MG50223-CH
Neurotrophin 3 cDNA ORF Clone, Mouse, N-His tag MG50223-NH
Neurotrophin 3 cDNA ORF Clone, Mouse, C-HA tag MG50223-CY
Neurotrophin 3 cDNA ORF Clone, Mouse, N-HA tag MG50223-NY
Neurotrophin 3 cDNA ORF Clone, Mouse, C-Myc tag MG50223-CM
Neurotrophin 3 cDNA ORF Clone, Mouse, N-Myc tag MG50223-NM
Neurotrophin 3 qPCR Primer Pairs, Mouse MP200250

Neurotrophin 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Neurotrophin 3 cDNA ORF Clone in Cloning Vector, Human HG10286-M
Neurotrophin 3 cDNA ORF Clone, Human, untagged HG10286-UT
Neurotrophin 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10286-ACGLN
Neurotrophin 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10286-ACG
Neurotrophin 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10286-ACR
Neurotrophin 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10286-CF
Neurotrophin 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10286-NF
Neurotrophin 3 cDNA ORF Clone, Human, C-His tag HG10286-CH
Neurotrophin 3 cDNA ORF Clone, Human, N-His tag HG10286-NH
Neurotrophin 3 cDNA ORF Clone, Human, C-HA tag HG10286-CY
Neurotrophin 3 cDNA ORF Clone, Human, N-HA tag HG10286-NY
Neurotrophin 3 cDNA ORF Clone, Human, C-Myc tag HG10286-CM
Neurotrophin 3 qPCR Primer Pairs, Human HP100331
info info
添加购物车成功! 添加购物车失败!